Labshake search
Citations for Agilent :
201 - 250 of 1924 citations for 7 Chloro 9 methyl 3 4 dihydro 2H benzo b oxepin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... Oligos were purchased as one pool from Agilent Technologies.
-
bioRxiv - Biophysics 2020Quote: ... DNA fragments: one from the pBlueScriptIISK+ plasmid (Stratagene) and the other from the pNLrep plasmid ...
-
bioRxiv - Biochemistry 2021Quote: ... One Color (Agilent Technologies, Part Number: 5190-0442). 500ng of each sample were denatured along with WT primer with a T7 polymerase promoter ...
-
bioRxiv - Molecular Biology 2023Quote: ... One drop of fluorescence mounting medium (Dako Agilent) was added and sections were sealed with a coverslip (24×50 mm).
-
bioRxiv - Molecular Biology 2023Quote: ... One drop of fluorescence mounting medium (Dako Agilent) was added and sections were sealed with a coverslip (24×50 mm).
-
bioRxiv - Genomics 2020Quote: ... B (Cat # 720202, Agilent Inc, Santa Clara CA, USA). Vector recovery from genomic DNA ...
-
bioRxiv - Genetics 2020Quote: ... and b-OH-butyrate levels were determined by Agilent LC/MS 6410 Triple Quad system as described (Nissim et al ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Data processing: MassHunter software (v B.05.01, Agilent UK). Calibration curves were fitted using the simplest regression model to minimize back-calculated calibration standard concentration residuals over the range of study sample concentrations.
-
bioRxiv - Microbiology 2022Quote: ... The MassHunter Quantitative Analysis Software (Agilent, version B.09.00) was used for peak integration based on retention time (tolerance of 0.2 min ...
-
bioRxiv - Cell Biology 2023Quote: ... and were processed using Qualitative Analysis B.06.00 (Agilent). The peak areas of adenylates were calculated using following parameters (m/z ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-CA125 epitope group B (Agilent, M11, 1:100), or anti-CA125 epitope group B (Fitzgerald ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2019Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation ...
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Evolutionary Biology 2019Quote: ... then assessed RNA quality using TapeStation (Agilent Technologies; RIN > 7). The Genome Sequencing and Analysis Facility at the University of Texas at Austin prepared TagSeq libraries ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA integrity (RINe ≥ 7) was confirmed using Tapestation 4200 (Agilent). The median RINe score was 9.2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis ...
-
bioRxiv - Genomics 2019Quote: ... Each pool of RNA was individually labelled with Cyanine-3 and Cyanine-5 (Cy3 and Cy5) using the Low input Quick Amp Labelling Kit (Agilent Technologies) followed by purification through Qiagen RNeasy Columns (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Genomics 2022Quote: ... The bisulfite-converted library was PCR amplified and indexed using the SureSelect XT Mouse Methyl-Seq Kit (Agilent, #G9651A). Prepared libraries were run on an Illumina sequencing platform using a NextSeq High 150 bp paired-end mode.
-
bioRxiv - Neuroscience 2020Quote: RNA samples (50-100 ng) with RIN scores from 7.6 to 9 (Agilent 4200 TapeStation) were reverse transcribed to cDNA ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were treated with an antigen retrieval solution (Target Retrieval pH 9, #S2367, DAKO) for 20 min ...
-
bioRxiv - Immunology 2020Quote: ... Rehydrated sections were immersed in epitope retrieval buffer (Target Retrieval Solution, pH 9, DAKO Agilent), incubated at 97 °C for 40 min and cooled down to 65 °C using Lab vision PT module (Thermofisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Rehydrated sections were immersed in epitope retrieval buffer (Target Retrieval Solution, pH 9, DAKO Agilent), incubated at 97 °C for 40 min and cooled down to 65 °C using Lab vision PT module (Thermofisher Scientific) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... an OD 260/280 ratio greater than 1.9 and a RIN > 9 (Agilent Bioanalyzer 2100) were chosen for cDNA library construction ...
-
bioRxiv - Microbiology 2021Quote: ... All other synthetic or expressed peptide substrates were purified and analyzed at small scale utilizing analytical-scale reverse-phase HPLC on an Agilent 1100 series HPLC system (Santa Clara, CA) employing an Eclipse Plus C18 column (5 μm, 4 × 150 mm) (Agilent) at a flow rate of 1 mL/min ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... using a Bravo Automated Liquid Handling Platform Option B (Agilent). All libraries were sequenced in the same way ...
-
bioRxiv - Plant Biology 2020Quote: For data deconvolution the software Profinder B.08.02 (Agilent Technologies) was used ...
-
bioRxiv - Biochemistry 2020Quote: ... we used Masshunter Qualitative Analysis version B.07 (Agilent Technologies) and the Molecular Feature Extraction tool to extract H+ ...
-
bioRxiv - Biophysics 2019Quote: ... Data was analysed using MassHunter Qualitative Analysis B.06.00 (Agilent). Compound purity was calculated using the highest value of %UV (at 254 nm ...
-
bioRxiv - Molecular Biology 2019Quote: ... MassHunter B.06.01 software (Agilent Technologies, Santa Clara, CA, USA) was used for all data acquisition and MZmine 2 was used for data processing (Pluskal et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... Data were acquired using Profinder B.08.00 SP3 software (Agilent). Intracellular relative abundance of metabolites was normalized to cell number for GC/MS samples or by total ion current (TIC ...
-
bioRxiv - Immunology 2021Quote: ... MassHunter B.06.01 software (Agilent Technologies, Santa Clara, CA, USA) was used for all data acquisition ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... MassHunter B.06.01 software (Agilent Technologies, Santa Clara, CA, USA) was used for all data acquisition and MZmine 2 was used for data processing.
-
bioRxiv - Biochemistry 2022Quote: ... M/z spectra were analysed using Masshunter B.07.00 (Agilent); ESIprot (49 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... The data was analyzed using MassHunter (Agilent version B.07.00). The retention times (RT ...
-
Macrodomain Mac1 of SARS-CoV-2 Nonstructural Protein 3 Hydrolyzes Diverse ADP-ribosylated SubstratesbioRxiv - Biochemistry 2023Quote: ... MassHunter Qualitative Analysis Version B.07 (Agilent Technologies, CA, USA). Spectral matching of obtained MS/MS spectra was performed with spectral libraries Human Metabolome Database (HMDB ...
-
bioRxiv - Physiology 2023Quote: ... and were processed using Qualitative Analysis B.06.00 (Agilent Technologies). Levels of AMP ...
-
bioRxiv - Physiology 2023Quote: ... and were processed using Qualitative Analysis B.06.00 (Agilent Technologies). Levels of AMP ...
-
bioRxiv - Physiology 2023Quote: ... and were processed using Qualitative Analysis B.06.00 (Agilent Technologies).
-
Changes in cell morphology and function induced by NRAS Q61R mutation in lymphatic endothelial cellsbioRxiv - Cell Biology 2023Quote: ... The systems were controlled by Agilent G2201AA ChemStation software version B.03.01 for CE (Agilent Technologies) and connected by a fused silica capillary (50 μm i.d ...
-
bioRxiv - Cell Biology 2023Quote: ... The systems were controlled by Agilent G2201AA ChemStation software version B.03.01 for CE (Agilent Technologies) and connected by a fused silica capillary (50 μm i.d ...
-
bioRxiv - Bioengineering 2020Quote: One-step Brilliant II RT-qPCR core kit (Agilent) was used for quantitative analysis of extracted HIV RNA ...
-
bioRxiv - Microbiology 2021Quote: ... Fatty acid methyl esters were identified by their mass spectrum and retention time and quantified by Mass Hunter Quantification Software (Agilent) and the calibration curve generated with fatty acid methyl esters standards mix (Sigma CRM47885) ...
-
bioRxiv - Genomics 2020Quote: ... The library preparations for the genome-wide data were performed according to the SureSelect XT Mouse Methyl-Seq Kit Enrichment System for Illumina Multiplexed Sequencing Library protocol (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... The extracted phospholipids were methanolized as fatty-acid methyl esters and then analysed using gas chromatography (Agilent Technologies 6890N, UK) [26] ...