Labshake search
Citations for Agilent :
251 - 300 of 3135 citations for 7 Chloro 3 4 dihydro 1 2H isoquinolinone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... All liver RNA samples had integrity numbers (RIN) ≥ 7 as verified with the Agilent 2100 Bioanalyser (Agilent Technologies, Waldbronn, Germany). A260/A280 were ≥ 1.8 as verified with Thermo Scientific™ NanoDrop 2000 spectrophotometer (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... sample input was 400 ng total RNA (determined by Qubit RNA HS reagents, Thermo) with RIN >7 (Bioanalyzer RNA Nano, Agilent). Libraries were prepared with the Biomek 400 Automated Workstation (Beckman Coulter) ...
-
bioRxiv - Biophysics 2022Quote: ... was pre-equilibrated with 10 mM pH 7 sodium phosphates with 150 mM NaCl on an Infinity 2 1260 HPLC system (Agilent) with an inline degasser ...
-
bioRxiv - Cell Biology 2021Quote: ... and were mutated by deleting 6-7 base pairs using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies). The primers used for mutagenesis are listed in Supplementary Table S6 ...
-
bioRxiv - Systems Biology 2022Quote: ... by an adaptation of the method described by Fuhrer et al.7 The analysis was performed utilizing an Agilent 1100 Series HPLC system (Agilent) coupled to a Gerstel MPS 3 autosampler (Gerstel) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Each sample pool was barcoded with a specific 10 bp-sequence attached at one side of the amplicons through PCR (7 cycles) and cleaned using AMPure beads (Agilent) at x0.7 ratio ...
-
bioRxiv - Developmental Biology 2020Quote: ... and purity/quality (RIN ≥ 7) was assessed on the 2200 TapeStation using the Agilent RNA ScreenTape (5067-5576 / 5067-5577 / 5067-5578, Agilent). PartB RNA was quantified and purity/quality was assessed on the 2100 Agilent BioAnlayzer using the Agilent small RNA kit (5067-1548 ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids expressing gfpA206K fusions to mgrB mutants (pSY3-9, pSY72-75, pJC1-7, pTG1-15) were created by either QuikChange site-directed mutagenesis (Stratagene) or Inverse PCR [58] using pAL38 as template ...
-
bioRxiv - Microbiology 2022Quote: ... SINV strain SVIA equivalent to MOI of 500 was irradiated for 7 minutes using a Stratalinker UV Crosslinker 1800 (Stratagene). Absence of infectious particles was confirmed through plaque assay on Vero cells ...
-
bioRxiv - Genomics 2022Quote: ... Hi-C material was then amplified from the beads with 7-9 cycles of PCR using Herculase II Fusion DNA polymerase (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA quality of the tissue sections (RIN > 7) was confirmed using the Agilent RNA 6000 Nano Kit on the Bioanalyzer 2100 system (Agilent). Visium spatial gene expression slides were processed according to manufacturer instructions (10X Genomics ...
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 534-554 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Bioengineering 2023Quote: ... read height of 7 mm and at 37 °C with excitation at 315-335 nm wavelength using a Cytation5 (Agilent). All values were subtracted by a control with only 8FN microgels and no cells.
-
bioRxiv - Developmental Biology 2023Quote: ... Approximately 300 animal caps from 7 independent experiments were collected and processed for TAP following manufacturer’s instructions (InterPlay Mammalian TAP System, Agilent Technologies). Samples subjected to TAP were sent for identification of proteins by nanoLC/MS/MS to MS Bioworks ...
-
bioRxiv - Genomics 2023Quote: ... For samples with a DNA integrity number (DIN) < 7 as assessed on an Agilent 2200 TapeStation (Agilent, Santa Clara, CA), 500 ng to 1 μg gDNA were fragmented if available ...
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2023Quote: ... This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5, Stratagene). 3T3 mouse embryonic fibroblasts (MEFs ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 4 was protein blocking (Background Sniper, Dako Protein Block or Normal block ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2023Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Neuroscience 2023Quote: ... Afterwards the sections were incubated in a humidified chamber (overnight 4°C) in a peroxidase conjugated immunoglobulin against UEA (DAKO, P289; 1:50). Finally ...
-
Retinal affectation in Huntington’s disease mouse models concurs with a local innate immune responsebioRxiv - Neuroscience 2023Quote: ... and incubated overnight in a humid chamber at 4°C with rabbit anti-glial fibrillary acidic protein (GFAP) antibody (1:500, Z0334, DAKO, Agilent, Glostrup, Denmark), rabbit anti-ionized calcium binding adaptor molecule 1 (Iba-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated for 1h at RT before overnight incubation at 4°C with primary antibodies: Glial Fibrillary Acidic Protein (GFAP) (1/500 Dako Cat. Number Z0334); AQP4 (1/500 ...
-
bioRxiv - Cancer Biology 2019Quote: ... For 8 other samples (1 normal and 3 tumor regions each from 2 patients) only DNA was isolated and targeted panel sequencing (Agilent SureSelect run on a HiSeq) was performed for 257 genes ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... All samples were depleted of the 7 most abundant proteins with the multiple affinity removal system (MARS Hu7 spin cartridge) according to the manufacturers protocol (Agilent Technologies). Samples were further reduced using 4 mM DTT ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Plant Biology 2023Quote: ... RNA samples of at least 200 ng total RNA and achieving a RINe greater than 7 on a 4200-tape station (Agilent Technologies) were selected for RNA sequencing ...
-
bioRxiv - Cell Biology 2020Quote: ... Germany) followed by overnight incubation at 4 °C with specific primary antibodies: polyclonal rabbit anti-human AAT (1:800) (DAKO A/S, Glostrup, Denmark), mouse monoclonal anti-AAT polymer antibody (clone 2C1 ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated overnight at 4°C in primary antibody (2% NGS in TBST) with either rabbit anti-GFAP (1:2000, Agilent Cat# Z0334, RRID: AB_10013382), rabbit anti-synaptophysin (IgG ...
-
bioRxiv - Cancer Biology 2019Quote: ... for 4 hours at 4°C with rotation and processed using the Agilent Bravo liquid handling system (Agilent Technologies, Santa Clara, CA). Beads were washed twice with 0.1% NP-40 in Tris-buffered saline (50 mM Tris-HCl with 150mM NaCl ...
-
bioRxiv - Biochemistry 2021Quote: ... at 4°C overnight diluted in antibody diluent (Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cell Biology 2020Quote: ... elegans V2 4*44K Microarray chip (Agilent Technologies, USA) at 65°C for 17 hrs ...
-
bioRxiv - Microbiology 2023Quote: ... which are handled with a stacker (BioStack 4, Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed with a 3-laser flow cytometer (Agilent Novocyte) and data were processed with FlowJo (v10.1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luminescence was measured using a Cytation 3 Image Reader (Agilent). The luminescence of vehicle-treated controls was set to 100% ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luciferase activities were measured with Cytation 3 Image Reader (Agilent). Firefly luciferase activities were normalized to those of the Renilla luciferase.
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was quantified using the Gen5 Take 3 Module (Agilent BioTek) and assessed for quality with 260/230 absorbance ratio ...
-
bioRxiv - Cancer Biology 2024Quote: ... Absorbase (450nm) was red with BioTek Cytation 3 (Agilent, California, US).
-
bioRxiv - Physiology 2021Quote: All samples with the QC and 7 high-pH fractions were acquired using an UHPLC 1290 system (Agilent Technologies; Santa Clara, USA) coupled on-line to an Q Exactive HF mass spectrometer (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... they were first permeabilized using an acetone freeze step for 7 min at -20° C before staining with guinea-pig anti-insulin (Dako, Carpinteria, CA), Alexa Fluor 488 or 647 goat anti-guinea-pig (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2019Quote: An FT-ICR-MS (7 Tesla, SolariXR, Bruker, Bremen, Germany) was used in the flow-injection mode (a HPLC 1260 Infinity from Agilent (Waldbronn, Germany) was used) ...