Labshake search
Citations for Agilent :
51 - 100 of 4904 citations for 7 Chloro 1 3 dihydro imidazo 4 5 c pyridin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: ... Antigen retrieval was carried out using Proteinase K (5 μg/ml, 7 mins, Dako, UK). Sections were rinsed in running tap water for 5 min ...
-
bioRxiv - Physiology 2020Quote: ... blocked with 3% BSA in PBS1 and incubated overnight at 4°C with primary polyclonal antibodies for glucagon and insulin (Dako, Agilent, Santa Clara, CA, USA) (Table S8) ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-mouse IgG (1.3 μg ml−1, 5% milk in PBST; Dako, P026002-2) or goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated with primary antibodies at 4°C overnight: mouse monoclonal anti-CD31 (1:100, JC70A, Dako), rabbit polyclonal anti-VWF (1:100 ...
-
bioRxiv - Neuroscience 2021Quote: ... Slides were incubated overnight at 4°C with the following primary antibodies: mouse anti-BrdU (1:100, Dako), rat anti-BrdU (1:100 Oxford Biotech) ...
-
bioRxiv - Cancer Biology 2020Quote: Patient-derived explant tissue sections were stained for cytokeratin (DAKO, Cat. M3515; 1:100 overnight at 4°C), α-smooth muscle actin (αSMA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sections were then incubated overnight at 4 °C with appropriate dilution of anti-Ki67 (1:100, Dako, M7240) in TBS containing Horse Serum (2%) ...
-
bioRxiv - Neuroscience 2024Quote: ... The primary incubation was performed overnight at 4°C (phospho-Ser129, BioLegend Cat # 825701, 1:2000; GFAP, DAKO Cat # GA524 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Molecular Biology 2021Quote: ... slides were blotted with the following primary antibodies: anti-insulin (IR00261-2, 1:4; Agilent Techologies) and anti-glucagon (g2654 ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Neuroscience 2020Quote: ... with 5% BSA and 0.4% triton X-100) followed by incubation overnight at 4°C with 1:500 rabbit anti-C3 antibody (Dako) and 1:10,000 guinea pig anti-vGluT2 (Synaptic Systems ...
-
bioRxiv - Physiology 2021Quote: ... Samples were incubated overnight at 4°C in primary antibodies targeting anti-insulin (1:200, Abcam #Ab7872, Dako #A0564), anti-glucagon (1:100 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step DNA was purified by Ampure XP beads (Beckmann Coulter Genomics #A63882) ...
-
bioRxiv - Cell Biology 2021Quote: ... overnight at 4°C after blocking with blocking solution (S3022, Dako) for 30 min ...
-
bioRxiv - Immunology 2019Quote: ... and then overnight at 4°C in rabbit anti-CD3 (Dako) in 1% (v/v ...
-
bioRxiv - Genetics 2020Quote: ... at 4°C followed by secondary antibody (Dako Cytomation, Glostrup, Denmark) for 30 min at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... overnight at 4°C in Dako REAL antibody diluent (Dako, S2022). To visualized the specific signal ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step ...
-
bioRxiv - Genomics 2022Quote: Cyanine-3 labeled cRNA was prepared using the One-Color Low input Quick Amp Labeling kit (Agilent). Dye incorporation and cRNA yield was measured with a NanoDrop ND1000 spectrophotometer (Thermofisher) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies were mouse anti-Cytokeratin 7 (DAKO - M7018, 1:400), Rabbit anti-Cytokeratin 20 (Abcam - ab76126 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by overnight incubation at 4 °C with α-α-SMA (1:400, mouse monoclonal, clone 1 A4, DAKO Agilent Technologies, Santa Clara, USA) or α-CD68 (1:2000 ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by overnight incubation at 4 °C with α-α-SMA (1:400, mouse monoclonal, clone 1 A4, DAKO Agilent Technologies, Santa Clara, USA) or α-CD68 (1:2000 ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein immunodetection was performed with primary abs diluted in blocking solution during overnight incubation at 4°C: rabbit polyclonal ab against alpha-1-antitrypsin (A0012, Dako, Agilent) at a 1:500 dilution ...
-
bioRxiv - Physiology 2022Quote: ... for 1 h at RT and incubated overnight at 4°C with 1:100 dilution of mouse anti-Ki67 antibody (Novocastra, Concord, ON, Canada) in antibody diluent (DAKO). Next ...
-
bioRxiv - Developmental Biology 2019Quote: ... for one hour at room temperature and incubated overnight at 4°C with 1:200 dilution of mouse anti-Ki67 antibody (Novocastra, Concord, ON, Canada) in antibody diluent (DAKO). Next ...
-
bioRxiv - Bioengineering 2022Quote: ... and incubated overnight at 4 °C with primary antibodies for the glial fibrillary acidic protein (GFAP; 1:1000, Z0334, Dako), ionised calcium-binding adapter molecule 1 (IBA1 ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C in primary antibodies (RFP from Chromotek 5f8-100 at 1:200, GFAP from Agilent DAKO Z033429-2 at 1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... then incubated overnight at 4°C in primary antibodies (RFP from Chromotek 5f8-100 at 1:200, GFAP from Agilent DAKO Z033429-2 at 1:500 ...
-
bioRxiv - Biochemistry 2023Quote: ... Shimadzu LC-10AT; autosampler: HiP sampler G1367A, T = 4°C, 10 µL injection; flow rate: 1 mL/min; column: Agilent Zorbax Eclipse XDB-C18 80Å ...
-
bioRxiv - Neuroscience 2023Quote: ... and kept at 4°C overnight with primary antibodies (chicken anti-GFP, Aves Labs, 1:4000; rabbit anti-GFAP, Agilent Pathology Solutions ...
-
bioRxiv - Genetics 2023Quote: ... Membranes were labelled with primary antibody for 1 hour at room temperature or overnight at 4°C followed by incubation with HRP-conjugated secondary antibodies (Dako). Membranes were developed using the Western Lightning ECL system (Perkin Elmer) ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibody incubation was performed overnight at 4 °C with rabbit monoclonal anti-PSyn EP1536Y diluted 1:320,000 in DAKO antibody diluent (Agilent #S0809). After three 5-min washes with PBST ...
-
bioRxiv - Cell Biology 2024Quote: hAC were fixed with 4% formalin and blocked for 1 h at 37°C (Protein-Block serum free, X0909 Dako Agilent). COL2 antibody (MA5-13026 ...
-
bioRxiv - Physiology 2023Quote: ... at 4 °C overnight and mounted with fluorescence mounting medium (Agilent, USA).
-
bioRxiv - Developmental Biology 2019Quote: ... Dye-swap hybridizations (2+2) were performed on microarray slides (4×44K zebrafish V3, Agilent) using gasket slides and a hybridization chamber and incubated for 17 h at 65°C and 10 rpm in the hybridization oven (Agilent Technologies) ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4′,6-diamidino-2-phenylindole; 1:1000) was used as nuclei staining and fluorescent mounting medium (DAKO) to cover the slides before imaging acquisition ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies diluted in blocking solution were incubated overnight at 4°C (anti-GFAP z0334 DAKO 1:400, anti-Iba1 019-19741 Wako 1:400). After three washes in PBS ...
-
bioRxiv - Physiology 2019Quote: ... tissues were incubated with primary antibody over night at 4°C (guinea pig anti-insulin at 1:750, DAKO; diluted in 1% goat serum/PBS). This was followed by 1-hour incubation with fluorophore-conjugated secondary antibodies (Cy3-anti-guinea pig ...
-
bioRxiv - Molecular Biology 2021Quote: ... β1-4 galactosidase (Agilent Technologies), or double digestion with Sialidase A and β-galactosidase ...
-
bioRxiv - Immunology 2024Quote: ... β(1-4)-Galactosidase (Prozyme) (designated as “G”) ...
-
bioRxiv - Neuroscience 2021Quote: ... Slides were then incubated overnight at 4°C with primary polyclonal anti-GFAP rabbit antibody (1:1000; Z0334, DAKO, Golstrup, Denmark) or anti-collagen IV rabbit antibody (1:200 ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein immunodetection was performed with primary abs diluted in blocking solution during overnight incubation at 4°C: rabbit polyclonal ab against alpha-1-antitrypsin (A0012, Dako, Agilent) at a 1:500 dilution ...
-
bioRxiv - Zoology 2020Quote: ... hydrated through graded ethanol and incubated overnight at 4°C with a mouse anti-human CD68 clone KP1 monoclonal antibody (1:100, Dako, Denmark). Then ...
-
bioRxiv - Cell Biology 2024Quote: hAC were fixed with 4% formalin and blocked for 1 h at 37°C (Protein-Block serum free, X0909 Dako Agilent). COL2 antibody (MA5-13026 ...
-
bioRxiv - Immunology 2024Quote: A total of 10 µg/ml rHA were coated on an ELISA plate at 4 °C ON and afterwards incubated with rabbit anti-HA antibody (1:2000 dilution) (Dako, A0001) 2h at RT ...