Labshake search
Citations for Agilent :
451 - 500 of 1799 citations for 7 CHLOROTHIENO 3 2 B PYRIDINE 6 CARBOXAMIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... Dye-swap hybridizations (2+2) were performed on microarray slides (4×44K zebrafish V3, Agilent) using gasket slides and a hybridization chamber and incubated for 17 h at 65°C and 10 rpm in the hybridization oven (Agilent Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... EnvP(b)1CS- with the furin cleavage site mutated from RKTR to SKTR was generated from the human EnvP(b)1 plasmid using QuikChange site-directed mutagenesis (Agilent). EnvP(b)1 iRBD sequences were synthesized and cloned into a modified pVRC8400 expression vector ...
-
bioRxiv - Biochemistry 2019Quote: ... and pZeoPTPζ-ΔD2 (the D2 deletion mutant of PTPRZ-B) was generated using pZeoPTPζ as a template with a Quikchange multisite-directed mutagenesis kit (Stratagene).
-
bioRxiv - Microbiology 2021Quote: ... and the Spike from the B.1.429 lineage (S13I, W152C, L452R, D614G) were generated using the QuikChange II XL site-directed mutagenesis kit (Agilent Technologies). The amino acid deletions in the full-length SARS-CoV-2 Spike expressor were generated using the Q5 site-directed mutagenesis kit (NEB) ...
-
bioRxiv - Biochemistry 2020Quote: Initial LC-MSMS discovery mode data for incorporation into a glycopeptide PCDL was performed using Masshunter Qualitative Analysis with Bioconfirm B.07.00 (Agilent Technologies). Compounds were identified using the Find by Molecular Feature (MFE ...
-
bioRxiv - Systems Biology 2020Quote: ... LCMS experiments were performed as described52 and all data processing was performed using the Masshunter Profinder version B.08.00 (Agilent Technologies). The processing was performed both in a target and an untargeted fashion ...
-
bioRxiv - Plant Biology 2021Quote: ... together with mass and retention time alignment (0.1 min and 5 ppm respectively) were done in Profinder B.07 software (from Agilent Technologies). Annotation was done based on the ‘find-by-formula’ algorithm ...
-
bioRxiv - Microbiology 2019Quote: ... and retention time (RT) were imported into a personal compound database and library (PCDL Manager, version B.07.00, Agilent Technologies) used in data processing workflow.
-
bioRxiv - Cell Biology 2022Quote: ... The SEC24A B- and C-site mutants were generated on pcDNA3.1-SmBiT-SEC24A using QuickChange site-directed mutagenesis (Agilent Technologies).
-
bioRxiv - Microbiology 2020Quote: ... Mutations to the NF-κB and IRF binding sites in pLTR(Sp1)-luciferase were generated using the QuickChange IIXL site-directed mutagenesis kit (Stratagene). Primers used for site-directed mutagenesis are listed in Table 1 ...
-
bioRxiv - Plant Biology 2022Quote: ... of target compounds were detected using the ‘find compound by formula’ function and analyzed by Masshunter qualitative and quantitative analysis software version B.07.00 (Agilent technologies). For untargeted analysis ...
-
bioRxiv - Genomics 2021Quote: ... The gel-like image of the 2100 Bioanalyzer result was visualized using the 2100 Expert Software (ver. B.02.11, Agilent Technologies) in pseudo colors with default settings ...
-
bioRxiv - Microbiology 2022Quote: ... The panel of individual RBM mutations in the full-length SARS-CoV-2 Spike expressor and the Spike from the B.1.429 lineage (S13I, W152C, L452R, D614G) were generated using the QuikChange II XL site-directed mutagenesis kit (Agilent Technologies) and were previously reported25 ...
-
bioRxiv - Biophysics 2022Quote: ... and we checked that we obtained a DTCCSHe within 785-791 Å2 of its previously determined value (788 Å2).23 The data were extracted using the IM-MS Browser software version B.08.00 (Agilent Technologies).
-
bioRxiv - Immunology 2022Quote: ... Seahorse XF Cell Culture Microplates were pre-treated with poly-D-lysine and 106 primary B cells or 105 DG75 cells were plate in Seahorse XF Base Medium (Agilent) supplemented with 2mM L-glutamine (Agilent) ...
-
bioRxiv - Molecular Biology 2023Quote: ... raw LC/MS data was processed by the Molecular Feature Extractor algorithm of MassHunter Qualitative Analysis software B.07.00 (Agilent Technologies). A list of all N-glycans was extracted using previously optimized application of spatial mouse brain glycome database35 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... to assess levels of serum psilocin and 2C-B (ng/mL) using liquid chromatography-tandem mass spectrometry liquid chromatography-tandem mass spectrometry (LC-MS/MS; Agilent, Waldbronn ...
-
Changes in cell morphology and function induced by NRAS Q61R mutation in lymphatic endothelial cellsbioRxiv - Cell Biology 2023Quote: ... Peaks were extracted using MasterHands, automatic integration software (Keio University, Tsuruoka, Yamagata, Japan)13 and MassHunter Quantitative Analysis B.04.00 (Agilent Technologies) to obtain peak information including m/z ...
-
bioRxiv - Cell Biology 2023Quote: ... Peaks were extracted using MasterHands, automatic integration software (Keio University, Tsuruoka, Yamagata, Japan) (45) and MassHunter Quantitative Analysis B.04.00 (Agilent Technologies) in order to obtain peak information including m/z ...
-
bioRxiv - Cell Biology 2022Quote: Raw LC-MS/MS data were processed using the Agilent Quantitative analysis software (version B.07.00 MassHunter, Agilent Technologies, USA). Relative quantification of metabolites was based on Extracted Ion Chromatogram (EIC ...
-
bioRxiv - Plant Biology 2023Quote: ... samples were injected and separated via gas chromatography on an Agilent 7890 B gas chromatograph (Agilent, Santa Clara, CA, U.S.A.). Coupled to this was a Pegasus HT TOFMS mass spectrometer (Leco Corporation ...
-
bioRxiv - Physiology 2023Quote: ... Some 20 μl of re-dissolved potion (b) and portion (c) solutions were then loaded into injection vials an injection vial (cat. 9301-0978, Agilent Technologies ...
-
bioRxiv - Biochemistry 2024Quote: ... a Personal Compound Database Library (PCDL) exclusively containing cholesterol and cholesteryl esters was curated using MassHunter PCDL manager B.08.00 (Agilent Technologies). The data files were processed in Agilent MassHunter Qualitative Analysis 10.0 using this PCDL library ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... using automatized integration of the peak area of each compound and standardization of the amount of each peak to its closest internal standard eluting before (MassHunter Workstation, Quantitative Analysis B.07.00 [Agilent Technologies]), thereby correcting for possible injection differences ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... All samples were depleted of the 7 most abundant proteins with the multiple affinity removal system (MARS Hu7 spin cartridge) according to the manufacturers protocol (Agilent Technologies). Samples were further reduced using 4 mM DTT ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Plant Biology 2023Quote: ... RNA samples of at least 200 ng total RNA and achieving a RINe greater than 7 on a 4200-tape station (Agilent Technologies) were selected for RNA sequencing ...
-
bioRxiv - Biochemistry 2021Quote: ... tissue sections were deparaffinized and permeabilized by citrate buffer (pH 6) for 25 min (Dako). Slices were blocked with 5% donkey serum (37°C ...
-
bioRxiv - Immunology 2020Quote: ... cDNA for Sp110 CARD (aa 6-110) were amplified from MegaMan Human Transcriptome Library (Stratagene). cDNA for the tandem SUMO interaction motifs of RNF4 (aa 38-129 ...
-
bioRxiv - Genetics 2019Quote: ... slides were incubated in antigen retrieval solution (Target Retrieval Solution Citrate pH 6; Dako cytomation) at 98°C for 20 minutes and then cooled at room temperature for 20 minutes ...
-
bioRxiv - Neuroscience 2019Quote: ... or hIL-6 downstream of a CMV promoter were co-transfected with pAAV-RC (Stratagene) encoding the AAV genes rep and cap ...
-
bioRxiv - Microbiology 2023Quote: ... using an ion-exchange column (Agilent Hi-Plex H, 300 × 7.7 mm, 6 μm I.D.) with isocratic elution using 5 mM H2SO4 at 50 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were then microwaved in the presence of DakoCytomation target retrieval solution pH 6 (Dako). Slides were incubated with 0.3% hydrogen peroxide solution in methanol for 15 minutes at room temperature to inhibit internal peroxide activity ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM Sodium Pyruvate (Agilent, 103578), and 1 mM Glutamine (ThermoFisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... PECAM1/CD31 (Agilent Technologies, M082329-2), PECAM1/CD31 (R&D Systems ...
-
bioRxiv - Neuroscience 2020Quote: ... Hematoxylin (Agilent Technologies; Cat S330930-2) was pipetted onto each section until completely covered and incubated for 7 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... GFAP (1.45μg/ml; Z033401-2; DAKO) and Ki67 (0.084μg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2022Quote: ... CD3 170Er (polyclonal, A045229-2, Dako), CD4 156Gd (clone EPR6855 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-SMA (M085129-2, Agilent). Anti-Perlecan antibody was a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... or anti-S100A1antibody (Dako, Z031129-2). Immunostained slides were counterstained with hematoxylin (Sigma) ...
-
bioRxiv - Neuroscience 2020Quote: ... Ki67 (Dako #M724001-2, 1:200). Full immunohistology protocol details available at http://help.brain-map.org/download/attachments/8323525/CellTypes_Morph_Overview.pdf?version=4&modificationDate=1528310097913&api=v2
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...
-
bioRxiv - Neuroscience 2021Quote: ... CD31 (Agilent, GA61061-2, 1:100), Olig2 (Millipore ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 μl of SureSelect probes (Agilent) were mixed with 2 μl of 25% RNAse block ...
-
bioRxiv - Immunology 2021Quote: ... HRP anti-Rabbit (Agilent, K400311-2) and EnVision+ Single Reagents ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2020Quote: ... CD68 (Agilent, #GA60691-2, Clone KP1), Cleaved Caspase 3 (CST ...