Labshake search
Citations for Agilent :
101 - 150 of 4560 citations for 7 Bromo 2 3 4 5 tetrahydro 1H benzo e 1 4 diazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
Bat influenza vectored NS1-truncated live vaccine protects pigs against heterologous virus challengebioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP)-conjugated polyclonal rabbit anti-mouse immunoglobulins (diluted 1:1000, room temperature, 1h reaction, Dako) were used as the secondary antibody.
-
bioRxiv - Genomics 2020Quote: ... and electroporated in 5 separate cuvettes containing 4 µL of the plasmid and 40 µL of ElectroTen-Blue electrocompetent cells (Agilent Santa Clara, CA). After a 1 hour outgrowth in LB at 37C ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Physiology 2020Quote: ... blocked with 3% BSA in PBS1 and incubated overnight at 4°C with primary polyclonal antibodies for glucagon and insulin (Dako, Agilent, Santa Clara, CA, USA) (Table S8) ...
-
bioRxiv - Biochemistry 2022Quote: ... with 4 cycles per step using Seahorse XFe96 Analyzer (Agilent). Cell Mito Stress Test was used for assessing mitochondrial function ...
-
bioRxiv - Biophysics 2019Quote: ... A 4 mm triple-resonance HXY MAS NMR probe (Agilent) was used under static condition ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were incubated with primary antibodies at 4°C overnight: mouse monoclonal anti-CD31 (1:100, JC70A, Dako), rabbit polyclonal anti-VWF (1:100 ...
-
bioRxiv - Neuroscience 2021Quote: ... Slides were incubated overnight at 4°C with the following primary antibodies: mouse anti-BrdU (1:100, Dako), rat anti-BrdU (1:100 Oxford Biotech) ...
-
bioRxiv - Immunology 2020Quote: ... FCCP [carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone] (1.5 μM) and Rotenone/Antimycin A (1 μM) (purchased from Agilent Technologies) were injected ...
-
bioRxiv - Cancer Biology 2020Quote: Patient-derived explant tissue sections were stained for cytokeratin (DAKO, Cat. M3515; 1:100 overnight at 4°C), α-smooth muscle actin (αSMA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sections were then incubated overnight at 4 °C with appropriate dilution of anti-Ki67 (1:100, Dako, M7240) in TBS containing Horse Serum (2%) ...
-
bioRxiv - Immunology 2023Quote: ... Antigens were tetramerized by incubation at a >4:1 ratio of biotinylated protein with streptavidin-PE (Agilent; PJRS25) or streptavidin-APC (Agilent ...
-
bioRxiv - Neuroscience 2024Quote: ... The primary incubation was performed overnight at 4°C (phospho-Ser129, BioLegend Cat # 825701, 1:2000; GFAP, DAKO Cat # GA524 ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Systems Biology 2023Quote: ... The cells were plated at 15,000 cells/well onto fibronectin-coated (5 μg/cm2) xCELLigence E-plate (Agilent) wells in serum free medium ...
-
bioRxiv - Bioengineering 2023Quote: ... ITO slides were then stained for H&E and imaged using the Cytation 5 (Agilent, Santa Clara, CA) and Epsilon scanner at 3000 dpi to select regions of interest using the open-source program ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies were mouse anti-Cytokeratin 7 (DAKO - M7018, 1:400), Rabbit anti-Cytokeratin 20 (Abcam - ab76126 ...
-
bioRxiv - Immunology 2022Quote: ... CF (R&D/BT10500-050) was incubated at a 4:1 molar ratio with either streptavidin-PE (Prozyme PJRS25) or streptavidin-APC (Prozyme PJ27S ...
-
bioRxiv - Cancer Biology 2021Quote: ... The resulting 40 samples were diluted 4:1 with Buffer A for Multiple Affinity Removal LC Columns (Agilent Technologies), filtered through a 0.22 μm hydrophilic PVDF membrane filter plate (Millipore) ...
-
bioRxiv - Neuroscience 2020Quote: ... with 5% BSA and 0.4% triton X-100) followed by incubation overnight at 4°C with 1:500 rabbit anti-C3 antibody (Dako) and 1:10,000 guinea pig anti-vGluT2 (Synaptic Systems ...
-
bioRxiv - Physiology 2021Quote: ... Samples were incubated overnight at 4°C in primary antibodies targeting anti-insulin (1:200, Abcam #Ab7872, Dako #A0564), anti-glucagon (1:100 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2-4 images at the central callus and distal callus regions were taken using an automatic microscope (Agilent, BioTek Lionheart FX, Santa Clara, CA). Central callus regions were defined as proximal to the fracture site on either side of the bone ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 µm tissue sections were stained and developed using AutostainerPlus (Dako). Antibodies were diluted in block solution and sections were incubated for 30 minutes with primary antibody and 20 minutes with secondary antibodies ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or Streptococcus pneumoniae β-N-Acetylhexosaminidase (Prozyme, 4 mU per digest) overnight at 37°C in 20 mM sodium acetate (pH 5.0).
-
bioRxiv - Cancer Biology 2019Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step DNA was purified by Ampure XP beads (Beckmann Coulter Genomics #A63882) ...
-
bioRxiv - Cancer Biology 2019Quote: Whole Human Genome Microarray Kit 4×44K (Agilent, Cat. No. G4112F) was used to detect mRNA expression levels in cells transfected with control and miR-101-3p transfected HCT116 cells ...
-
bioRxiv - Cell Biology 2021Quote: ... overnight at 4°C after blocking with blocking solution (S3022, Dako) for 30 min ...
-
bioRxiv - Cell Biology 2019Quote: ... Each SBC mouse (4*180K) LncRNA microarray slide (Agilent Technologies Inc.) was hybridized with 1.65 μg Cy3-labeled cRNA using a gene expression hybridization kit (Agilent Technologies ...
-
bioRxiv - Immunology 2019Quote: ... and then overnight at 4°C in rabbit anti-CD3 (Dako) in 1% (v/v ...
-
bioRxiv - Genetics 2020Quote: ... at 4°C followed by secondary antibody (Dako Cytomation, Glostrup, Denmark) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... using the Canis (V2) Gene Expression Microarray 4×44K (Agilent Technologies). Microarray data were subjected to gene ontology (GO ...
-
bioRxiv - Immunology 2022Quote: ... overnight at 4°C in Dako REAL antibody diluent (Dako, S2022). To visualized the specific signal ...
-
bioRxiv - Genomics 2023Quote: ... elegans (V2) Gene Expression Microarray 4 × 44k chips were used (Agilent). Scanning was done with an Agilent High Resolution C Scanner ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step ...
-
bioRxiv - Biochemistry 2023Quote: ... Absorbance was measured using a BioTek Synergy 4 plate reader (Agilent).
-
bioRxiv - Immunology 2020Quote: ... (e) DNA quantification by Agilent High-sensitive DNA chip verifies the composition of extracted NET samples ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were blocked for 1h with serum-free block (Dako, X0909), and incubated over-night with our custom-made DDX5 antibodies (1:500 ...
-
bioRxiv - Biochemistry 2020Quote: ... Complete imidazolinone conversion was checked by 1H-NMR (MR400 MHz, Agilent) For the reversal tests ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by overnight incubation at 4 °C with α-α-SMA (1:400, mouse monoclonal, clone 1 A4, DAKO Agilent Technologies, Santa Clara, USA) or α-CD68 (1:2000 ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by overnight incubation at 4 °C with α-α-SMA (1:400, mouse monoclonal, clone 1 A4, DAKO Agilent Technologies, Santa Clara, USA) or α-CD68 (1:2000 ...
-
mTOR inhibition enhances delivery and activity of antisense oligonucleotides in uveal melanoma cellsbioRxiv - Cancer Biology 2021Quote: ... or 1 µM (OMM1) carbonyl cyanide 4-(trifluoromethoxy)-phenylhydrazone (FCCP) and 0.5 µM of a rotenone antimycin A mix (Agilent Technologies). Following the assay ...
-
bioRxiv - Neuroscience 2022Quote: ... The plasma (50 µL) was diluted with 150 µL of buffer A (1:4 dilutions, as recommended by Agilent Technologies), and then filtered to remove particulates using a 0.45 μm spin filter (Spin-X centrifuge tube filter ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein immunodetection was performed with primary abs diluted in blocking solution during overnight incubation at 4°C: rabbit polyclonal ab against alpha-1-antitrypsin (A0012, Dako, Agilent) at a 1:500 dilution ...
-
bioRxiv - Physiology 2022Quote: ... for 1 h at RT and incubated overnight at 4°C with 1:100 dilution of mouse anti-Ki67 antibody (Novocastra, Concord, ON, Canada) in antibody diluent (DAKO). Next ...
-
bioRxiv - Developmental Biology 2019Quote: ... for one hour at room temperature and incubated overnight at 4°C with 1:200 dilution of mouse anti-Ki67 antibody (Novocastra, Concord, ON, Canada) in antibody diluent (DAKO). Next ...
-
bioRxiv - Molecular Biology 2019Quote: ... High mass accuracy was achieved by infusion of 1:4 diluted ESI low concentration tune mix (Agilent Technologies, Waldbronn, Germany) at the start of each chromatographic run ...
-
bioRxiv - Developmental Biology 2021Quote: ... Half of the cDNA was amplified for 17 PCR cycles and a 1:4 dilution of the resulting library was assessed by Agilent Bioanalyzer High Sensitivity DNA kit ...
-
bioRxiv - Immunology 2021Quote: ... cells were fixed in 4% PFA and sequentially stained with mAbs to NPM (anti-human/mouse nucleophosmin (NPM) (clone 376, dilution 1:50, Dako) and anti-mouse MPO (Millipore) ...