Labshake search
Citations for Agilent :
551 - 600 of 4083 citations for 7 BROMO 2 1 3 BENZOTHIADIAZOLE 4 SULFINIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2023Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Neuroscience 2023Quote: ... Afterwards the sections were incubated in a humidified chamber (overnight 4°C) in a peroxidase conjugated immunoglobulin against UEA (DAKO, P289; 1:50). Finally ...
-
Retinal affectation in Huntington’s disease mouse models concurs with a local innate immune responsebioRxiv - Neuroscience 2023Quote: ... and incubated overnight in a humid chamber at 4°C with rabbit anti-glial fibrillary acidic protein (GFAP) antibody (1:500, Z0334, DAKO, Agilent, Glostrup, Denmark), rabbit anti-ionized calcium binding adaptor molecule 1 (Iba-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated for 1h at RT before overnight incubation at 4°C with primary antibodies: Glial Fibrillary Acidic Protein (GFAP) (1/500 Dako Cat. Number Z0334); AQP4 (1/500 ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... All samples were depleted of the 7 most abundant proteins with the multiple affinity removal system (MARS Hu7 spin cartridge) according to the manufacturers protocol (Agilent Technologies). Samples were further reduced using 4 mM DTT ...
-
bioRxiv - Immunology 2022Quote: ... The assay was performed for the next 7 days and each day absorbance was read at 570 nm using Cytation 5 Cell Imaging Multi-Mode Reader (Agilent, BioTek). The assay was performed in triplicate.
-
bioRxiv - Plant Biology 2023Quote: ... RNA samples of at least 200 ng total RNA and achieving a RINe greater than 7 on a 4200-tape station (Agilent Technologies) were selected for RNA sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... W503F (PBD, polo-box domain 1) and H629A, K631M (PBD, polo-box domain 2) were generated by site-directed mutagenesis (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Exome sequencing was performed on genomic DNA from Patients 1 and 2 and their parents using a SureSelect Human All Exon kit (Agilent Technologies) for targeted enrichment ...
-
bioRxiv - Immunology 2022Quote: ... OCR and ECAR were measured at 37°C in Seahorse XF DMEM medium (pH7.4, with 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate) (Agilent, 103680-100). 1.5 μM Oligomycin ...
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were the following: goat anti-mouse IgG conjugated to horseradish peroxidase (IB: 1:10,000, cat#P044701-2 Dako, Glostrup, Denmark), donkey anti-Rabbit IgG Alexa Fluor 488 (IF ...
-
bioRxiv - Immunology 2024Quote: ... 11 cycles of TCR target enrichment PCR 1 and 2 were performed and the resulting cDNA was quantified on an Agilent Bioanalyzer High Sensitivity chip (Agilent Technologies). TCR libraries were prepared and indexed with 9 cycles of amplification using the PN-220103 Chromium i7 Sample Index Plate ...
-
bioRxiv - Molecular Biology 2024Quote: ... washed in TBST and incubated for 1-2 h with the peroxidase-coupled secondary antibody (HRP-coupled anti-rabbit IgG (Dako, #P0448), HRP-coupled anti-mouse IgG (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Germany) followed by overnight incubation at 4 °C with specific primary antibodies: polyclonal rabbit anti-human AAT (1:800) (DAKO A/S, Glostrup, Denmark), mouse monoclonal anti-AAT polymer antibody (clone 2C1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were submitted to the Stanford Protein and Nucleic Acid Facility for quality assessment by Agilent Bioanalyzer to determine the RNA integrity (RIN ...
-
bioRxiv - Microbiology 2022Quote: ... Separation of bile acids was performed on a 1290 series HPLC from Agilent (Santa Clara, CA) using an Agilent SB-C18 2.1X100mm 1.8 µm column with a 2.1X5mm 1.8um guard column ...
-
bioRxiv - Cell Biology 2022Quote: ... Amino acid substitutions and deletions were introduced by site-directed mutagenesis using the QuikChange Kit (Agilent).
-
bioRxiv - Cell Biology 2019Quote: A fluorescein-conjugated peptide nucleic acid (PNA) telomere detection kit for flow cytometry (Cat.#K5327, Dako) was used following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2020Quote: ... Amino acids were then converted into respective fluorescent derivatives using o-phthalaldehyde (OPA) (Agilent #5061-3335). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... acidified with formic acid and subsequently desalted using AssayMap C18 cartridges (Agilent, Santa Clara, CA, USA) mounted on an Agilent AssayMap BRAVO liquid handling system ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase A consisted of water with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Cancer Biology 2022Quote: We used the Seahorse XF Long Chain Fatty Acid Oxidation Stress Test kit (Agilent, 102720-100). Cells were incubated in assay media supplemented with 150 µM BSA or oleic acid conjugated to BSA as fatty acid substrate in the following formulation ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The concentrations of glucose and organic acids were detected by a HPLC (Agilent 1260, Waldbronn, Germany) equipped with a refractive index detector (RID) ...
-
bioRxiv - Immunology 2021Quote: ... Quality and integrity of nucleic acids were assessed using the Agilent Technologies 2100 Bioanalyzer (Agilent Technologies) after each step ...
-
bioRxiv - Synthetic Biology 2023Quote: The residual glucose and organic acids were analyzed using high performance liquid chromatography (HPLC, Agilent, USA) equipped with a refractive index detector (RID ...
-
bioRxiv - Physiology 2023Quote: ... amino acids and nicotinamide adenine dinucleotide reduced (NADH) and oxidized (NAD+) forms) was created from Agilent METLIN PCDL for identification within the samples ...
-
bioRxiv - Plant Biology 2023Quote: The AtSHMT1 (AT4G37930) amino acid substitutions were generated using a site-directed mutagenesis kit protocol (Stratagene). The primer-SD was used for Ser190 Leu ...
-
bioRxiv - Biochemistry 2023Quote: ... the bile acids identified were analyzed by Mass Hunter Qualitative 10.0 qualitative (Version B.10.0, Agilent software metabolomics ...
-
bioRxiv - Cell Biology 2023Quote: ... Amino acid substitutions and deletions were introduced by site-directed mutagenesis using the QuikChange Kit (Agilent). Sequences of the primers used are listed in the Supplementary Table S7.
-
bioRxiv - Cancer Biology 2019Quote: ... for 4 hours at 4°C with rotation and processed using the Agilent Bravo liquid handling system (Agilent Technologies, Santa Clara, CA). Beads were washed twice with 0.1% NP-40 in Tris-buffered saline (50 mM Tris-HCl with 150mM NaCl ...
-
bioRxiv - Biochemistry 2021Quote: ... at 4°C overnight diluted in antibody diluent (Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cell Biology 2020Quote: ... elegans V2 4*44K Microarray chip (Agilent Technologies, USA) at 65°C for 17 hrs ...
-
bioRxiv - Microbiology 2023Quote: ... which are handled with a stacker (BioStack 4, Agilent Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM Sodium Pyruvate (Agilent, 103578), and 1 mM Glutamine (ThermoFisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... PECAM1/CD31 (Agilent Technologies, M082329-2), PECAM1/CD31 (R&D Systems ...
-
bioRxiv - Neuroscience 2020Quote: ... Hematoxylin (Agilent Technologies; Cat S330930-2) was pipetted onto each section until completely covered and incubated for 7 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... GFAP (1.45μg/ml; Z033401-2; DAKO) and Ki67 (0.084μg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2022Quote: ... CD3 170Er (polyclonal, A045229-2, Dako), CD4 156Gd (clone EPR6855 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-SMA (M085129-2, Agilent). Anti-Perlecan antibody was a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... or anti-S100A1antibody (Dako, Z031129-2). Immunostained slides were counterstained with hematoxylin (Sigma) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...