Labshake search
Citations for Agilent :
1 - 50 of 498 citations for 7 BENZYL 3 7 DIAZABICYCLO 4.2.0 OCTANE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... p53 (clone DO-7; Dako-Agilent) PTEN (clone 6H2.1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Approximately 7× 106 AAV 293 cells (Agilent) were seeded in DMEM containing 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... 7 mm column (Agilent, Santa Clara, USA), using an 8 min linear gradient of 40% to 100% methanol in acetic acid (0.1% v/v ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Neuroscience 2022Quote: ... Scans were on a 7-T scanner (Agilent, Santa Clara ...
-
bioRxiv - Cell Biology 2023Quote: ... and confirmed for RIN > 7 (Agilent 2100 Bioanalyzer). cDNA libraries were constructed at Azenta (South Plainfield ...
-
bioRxiv - Genomics 2024Quote: ... and RNA integrity (RIN > 7, Bioanalyzer 2100, Agilent), RNA was depleted of rRNA using the QIAseq FastSelect RNA Removal Kit (Qiagen) ...
-
bioRxiv - Biophysics 2020Quote: ... flow cytometry analysis was performed by using the trophoblast-specific epithelial cell marker cytokeratin 7 (Maldonado-Estrada et al., 2004) (anti-cytokeratin 7, Dako, Switzerland). Vimentin (anti-vimentin ...
-
bioRxiv - Cancer Biology 2019Quote: ... for p53 (clone DO-7, Dako, Carpinteria, California, USA) at 1:50 dilution and for Pax8 (clone MRQ-50 ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-Cytokeratin 7 (1:00; Agilent Technologies, M701829-2), anti-Cytokeratin 19 (1:100 ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by incubation with 7 μl StrataClean beads (Agilent) for 16 h at 4°C with constant tumbling ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... then assessed RNA quality using TapeStation (Agilent Technologies; RIN > 7). The Genome Sequencing and Analysis Facility at the University of Texas at Austin prepared TagSeq libraries ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA integrity (RINe ≥ 7) was confirmed using Tapestation 4200 (Agilent). The median RINe score was 9.2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the clone DO-7 monoclonal antibody (GA61661-2, Dako Omnis ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies were mouse anti-Cytokeratin 7 (DAKO - M7018, 1:400), Rabbit anti-Cytokeratin 20 (Abcam - ab76126 ...
-
bioRxiv - Neuroscience 2021Quote: ... Images were acquired on a 7 Tesla MRI scanner (Agilent Inc.) (23 ...
-
bioRxiv - Immunology 2023Quote: ... or R-phycoerythrin-cyanine-7 (PE-Cy7) fluorochromes (Prozyme, Thermo-Fisher).
-
bioRxiv - Microbiology 2019Quote: ... Good quality RNA (RIN > 7, assessed by a Bioanalyzer 2100 (Agilent Technologies)) from total RNA and rRNA-subtracted RNA were converted to cDNA as described by (49 ...
-
bioRxiv - Immunology 2021Quote: A multi-channel 7 Tesla MRI scanner (Agilent Inc., Palo Alto, CA) was used to image brains in skulls ...
-
bioRxiv - Genetics 2019Quote: ... The libraries were amplified 7× using Herculase II Fusion Polymerase kit (Agilent).
-
bioRxiv - Neuroscience 2023Quote: ... At day 7 of differentiation astrocytes were switched to XF media (Agilent) and then assessed using the previously described Mitochondrial Stress Test Protocol [24] ...
-
bioRxiv - Molecular Biology 2019Quote: ... We measured O2 consumption of fully differentiated adipocytes at day 7 with an XF24-3 extracellular flux analyzer (Agilent Technologies, Santa Clara, CA, USA). Basal respiration was also assessed in untreated cells.
-
bioRxiv - Molecular Biology 2021Quote: ... was generated from a 7-kb genomic clone from Lambda FIX Library (Stratagene) (Supplemental Fig ...
-
bioRxiv - Neuroscience 2019Quote: ... T2-weighted RARE images were acquired on a 7-T scanner (Varian/Agilent) with imaging parameters ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA quality (RIN > 7) was confirmed using an RNA 6000 Nano Kit (Agilent). Spatial gene expression slides were processed following manufacturer instructions (Visium Spatial Gene Expression Reagent Kits User Guide ...
-
bioRxiv - Neuroscience 2022Quote: ... Postmortem data were then acquired on an 7 T small animal scanner (Agilent) fitted with a 40 G/cm gradient coil (Agilent ...
-
bioRxiv - Immunology 2023Quote: ... or cyan-7 conjugated R-phycoerythrin (PECy7) fluorochrome-conjugated streptavidin (Prozyme, Thermo-Fisher).
-
bioRxiv - Cancer Biology 2019Quote: TP53 Immunohistochemistry was performed with the mouse monoclonal antibody Do-7 (Dako, Glostrup, Denmark), according to standard protocols.
-
bioRxiv - Neuroscience 2021Quote: A 7 T horizontal small-bore magnet and (Agilent Technologies Inc, Santa Clara, USA) and a quadrature volume radiofrequency coil (39 mm internal diameter ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples with RIN values above 7 in the Bioanalyzer RNA 6000 Nano assay (Agilent) were used for the synthesis of complementary DNA and RT controls using a reverse transcription TATAA GrandScript cDNA Synthesis Kit (TATAA Biocenter) ...
-
bioRxiv - Cancer Biology 2022Quote: ... RIN (7-10) was calculated by capillary electrophoresis in a Bioanalizer (Agilent, Waldbronn, Germany). 2.5 µg (100 ng/µL ...
-
bioRxiv - Cancer Biology 2023Quote: ... RIN (7-10) was calculated by capillary electrophoresis in a Bioanalyzer (Agilent, Waldbronn, Germany).
-
PRC1 directs PRC2-H3K27me3 deposition to shield adult spermatogonial stem cells from differentiationbioRxiv - Developmental Biology 2023Quote: ... 7-µm-thick paraffin sections were deparaffinized and autoclaved in target retrieval solution (DAKO) for 10 min at 121°C ...
-
bioRxiv - Genomics 2024Quote: ... the integrity (RIN > 7) and concentration (ng/µl) were accessed using Bioanalyzer 2100 (Agilent). At last ...
-
bioRxiv - Molecular Biology 2021Quote: ... The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent). Libraries were next hybridized in the following way ...
-
bioRxiv - Molecular Biology 2022Quote: ... The libraries were amplified with 7 PCR cycles using Herculase II Fusion Polymerase kit (Agilent). Libraries hybridisation was performed as described previously 68 using probes mapping to 122 polycomb target genes promoters and 78 control active gene promoters ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-p53 (Clone DO-7) (1:1000, #M7001, DAKO, Agilent, Santa Clara, California, USA) and mouse anti-beta Actin (Clone C4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-p53 (Clone DO-7) (1:1000, #M7001, DAKO, Agilent, Santa Clara, California, USA) and mouse anti-beta Actin (Clone C4 ...
-
bioRxiv - Pathology 2023Quote: ... Antigen retrieval was carried out using Proteinase K (5 μg/ml, 7 mins, Dako, UK). Sections were rinsed in running tap water for 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... MRI of lung was performed with a 7-T Agilent scanner (Agilent, Santa Clara, CA, USA) equipped with a DD2 console and an actively shielded gradient set (205/120 insert of maximum 130 mT m-1 gradient strength) ...
-
bioRxiv - Cancer Biology 2020Quote: TP53 IHC was performed using monoclonal anti-TP53 antibody clone DO-7 (Dako, Carpinteria, CA, USA) using standard techniques described elsewhere57 on whole BM biopsy sections in a CLIA-certified laboratory ...
-
bioRxiv - Bioengineering 2022Quote: Dynamic release was performed using the 400-DS Apparatus 7 instrument (Agilent Technologies, Santa Clara, CA) at 37 °C in a 10 mL cell ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA quality was assessed with a 2100 Bioanalyzer instrument (Agilent, RIN score ≥ 7, 28S/18S ≥ 1). RNA concentration was measured using a Nanodrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA with RNA Integrity Number (RIN) > 7 when assessed using the Agilent 2100 Bioanalyzer (Agilent, USA) were selected to move forward for further sequencing.
-
bioRxiv - Physiology 2024Quote: MRI studies were performed using a 7-T Agilent/Varian scanner (Agilent, Santa Clara, CA, USA) equipped with a DD2 console ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescent images were obtained on a Keyence BZ-X710 microscope or on a Cytation 7 (Agilent).