Labshake search
Citations for Agilent :
51 - 100 of 1013 citations for 7 ACETOXY 6 METHOXY 3 4 DIHYDROQUINAZODIN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... Each SBC mouse (4*180K) LncRNA microarray slide (Agilent Technologies Inc.) was hybridized with 1.65 μg Cy3-labeled cRNA using a gene expression hybridization kit (Agilent Technologies ...
-
bioRxiv - Immunology 2019Quote: ... and then overnight at 4°C in rabbit anti-CD3 (Dako) in 1% (v/v ...
-
bioRxiv - Genetics 2020Quote: ... at 4°C followed by secondary antibody (Dako Cytomation, Glostrup, Denmark) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... using the Canis (V2) Gene Expression Microarray 4×44K (Agilent Technologies). Microarray data were subjected to gene ontology (GO ...
-
bioRxiv - Immunology 2022Quote: ... overnight at 4°C in Dako REAL antibody diluent (Dako, S2022). To visualized the specific signal ...
-
bioRxiv - Genomics 2023Quote: ... elegans (V2) Gene Expression Microarray 4 × 44k chips were used (Agilent). Scanning was done with an Agilent High Resolution C Scanner ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step ...
-
bioRxiv - Biochemistry 2023Quote: ... Absorbance was measured using a BioTek Synergy 4 plate reader (Agilent).
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Plant Biology 2020Quote: ... Hybridizations were done using a custom 4×44 k oligoarray (Agilent Technologies) that was previously described15,25 ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 4°C overnight diluted 1:200 in antibody diluent (#S3022, Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×180K or 8×60K SurePrint G3 human CGH microarray (Agilent Technologies) according to manufacturer’s instructions (CGH enzymatic protocol v6.2 ...
-
bioRxiv - Immunology 2020Quote: ... FLAG-tagged YTHDF1 was cloned into pCMV-Tag 4 vector (Agilent, #211174); Myc-tagged DDX60 was cloned into pRK-5 vector (BD PharMingen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sections were incubated at 4°C with anti-VWF (1:200, Dako) and anti-α-smooth muscle actin (1:100 ...
-
bioRxiv - Genomics 2021Quote: ... diluted to 4 nM and QC’d on the Bioanalyzer (Agilent Technologies, USA). The final pool was sequenced on Illumina MiSeq platform 2×300 bp using the MiSeq Reagent Kit V3 (600 cycles PE ...
-
bioRxiv - Physiology 2023Quote: ... at 4 °C overnight and mounted with fluorescence mounting medium (Agilent, USA).
-
bioRxiv - Immunology 2023Quote: ... 4 μM oligomycin and 50 mM 2-DG (Agilent, Cat# 103020-100).
-
bioRxiv - Developmental Biology 2023Quote: ... The signal was detected with BioTek Synergy 4 Microplate reader (Agilent Technologies), and the results were analyzed using a 4-parameter logistic regression algorithm (http://www.elisaanalysis.com/app) ...
-
bioRxiv - Neuroscience 2024Quote: ... PSCs were then labeled with a S100 rabbit antibody (1:4, DAKO) for 2 h at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... Wall air was passed through a hydrocarbon filter (Agilent Technologies, HT200-4) and split into a 100 mL/min odor stream and 900 mL/min carrier stream using analog flowmeters (Cole-Parmer ...
-
bioRxiv - Cell Biology 2020Quote: ... Cytokeratin 7 (DAKO, M7018)] in blocking buffer overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... pooled at 4 nM and quality-assessed on a 2100 Bioanalyzer (Agilent Technologies). Sequencing was performed on an Illumina MiSeq (paired-end ...
-
bioRxiv - Cancer Biology 2020Quote: ... SureFISH chr4 CEP 613kb green for the centromere of chromosome 4 (#G101066G, Dako), FISH RAMP1 red for the RAMP1 gene (#G110996X-8 ...
-
bioRxiv - Immunology 2021Quote: ... Cy-dye labelling and hybridization to Agilent High Definition 4×44k array (Agilent technologies ...
-
bioRxiv - Physiology 2022Quote: ... We used a Mouse Gene Expression 4 × 44K Microarray chip (G4846A, Agilent Technologies), which can examine 23,215 genes as described [30] ...
-
bioRxiv - Immunology 2023Quote: ... mCTLA-4 cDNA was sub-cloned into the pCMV-Tag4A vector (Agilent Technologies) and an exon3 deletion construct was made by the KOD Plus Mutagenesis Kit (TOYOBO) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with small RNA ladder (4-150nt) were used (cat no. 5067-1550, Agilent), all accessory reagents were also from Agilent (cat no ...
-
bioRxiv - Immunology 2023Quote: ... The tissue was then incubated overnight at 4°C with anti-CD4 (Dako) in a 1:10 dilution ...
-
bioRxiv - Cancer Biology 2022Quote: ... Slides were next incubated overnight at 4°C with anti-PCNA antibody (DakoCytomation, clone PC10 ...
-
Lactylation-driven FTO-mediated m6A modification of CDK2 aggravates diabetic microvascular anomaliesbioRxiv - Cell Biology 2023Quote: ... Lactate content was monitored using a Synergy 4 automatic microplate reader (Agilent BioTek) at 570 nm.
-
Short-range interactions between fibrocytes and CD8+ T cells in COPD bronchial inflammatory responsebioRxiv - Pathology 2023Quote: ... Nonspecific binding was minimized by incubating the sections with 4% Goat Serum (Agilent) for 30 min ...
-
bioRxiv - Immunology 2024Quote: ... Each sample was run on a 4% agarose gel and TapeStation 4150 (Agilent) to verify the presence of PCR products of the appropriate size (383 bp) ...
-
bioRxiv - Cancer Biology 2022Quote: ... clone DO-7 (M7001, DAKO) and the BOND™ Polymer Refine Detection System (DS9800 ...
-
Structural determinants of protocadherin-15 elasticity and function in inner-ear mechanotransductionbioRxiv - Biophysics 2019Quote: ... mutation p.V250N was introduced in EC1-4 using the QuikChange Lightning mutagenesis kit (Agilent), and all constructs were sequence verified ...
-
bioRxiv - Plant Biology 2022Quote: ... and hybridized to a rice 4 × 44 K custom oligo DNA microarray (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... A C18 reversed phase column (Poroshell 120 EC-C18, 4 μm, 4.6x150 mm, Agilent) was used for the separation ...
-
bioRxiv - Plant Biology 2021Quote: ... Arabidopsis Gene Expression Microarray chip version 4 with 43,803 Arabidopsis probes (G2519F; Agilent Technologies) was used for the microarray analysis ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Samples were diluted 4 times in water and ran on a Bioanalyzer (Agilent Technologies) to determine cDNA concentration ...
-
bioRxiv - Immunology 2020Quote: ... sections were probed with an anti-HSV antibody incubated overnight at 4°C (Dako), a donkey anti-rabbit IgG-HRP antibody (Jackson Immunoresearch ...
-
bioRxiv - Cell Biology 2019Quote: ... One-Color (Agilent Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... one color (Agilent Technologies), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... and 6’-Sialyllactosamine (6’SLN) (Prozyme, Hayward CA) were used to annotate HPLC peaks ...
-
bioRxiv - Cell Biology 2019Quote: ... for 1hr and incubated OVN at 4°C with indicated primary antibodies: αSMA (Dako, M0851); Desmin (Abcam ...
-
bioRxiv - Molecular Biology 2020Quote: ... and crosslinking was performed at 100mJ/cm2 at 4°C in a Stratalinker 1800 (Stratagene). Crosslinked cells where harvested by scraping in cold 1xPBS and pelleted at 700xg for 2min ...
-
bioRxiv - Cancer Biology 2020Quote: ... Each section was treated with 4 drops of serum-free protein block (Agilent cat # X0909) for 20 minutes at room temperature ...
-
bioRxiv - Genetics 2019Quote: ... anserina consisted of a custom 4×44 K platform (AMADID 018343, Agilent, Santa Clara, USA) containing 10,556 probes on each array with each probe in four replicates ...
-
bioRxiv - Genetics 2022Quote: ... the DNAs were hybridized on CGH 4 × 180 K mouse slides (AMADID 027411, Agilent Technologies). Finally ...
-
bioRxiv - Developmental Biology 2019Quote: ... Dye-swap hybridizations (2+2) were performed on microarray slides (4×44K zebrafish V3, Agilent) using gasket slides and a hybridization chamber and incubated for 17 h at 65°C and 10 rpm in the hybridization oven (Agilent Technologies) ...
-
bioRxiv - Pathology 2020Quote: ... Primary antibodies were incubated overnight at 4°C and appropriate HRP-conjugated secondary antibodies (DAKO, Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA from 4 independent replicates were checked on RNA6000 RNA chips on Bioanalyzer (Agilent) for its quality and integrity ...