Labshake search
Citations for Agilent :
201 - 250 of 1510 citations for 7 11 Dimethyldodeca 4 6 10 trien 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The Brilliant III Ultra-Fast SYBR® Green one-step qRT-PCR kit (Agilent) was used for all qRT-PCR reactions ...
-
bioRxiv - Cell Biology 2021Quote: ... The recombinant transfer vector was linearized by PmeI and transformed into electro-competent E.coli strain BJ5183-AD-1 (Stratagene, Cat. No. 200157-11) for in vivo recombination with pAdEasy vector ...
-
bioRxiv - Evolutionary Biology 2023Quote: DNA batch purity and integrity were assessed using a DS-11 spectrophotometer (Denovix, Wilmington, DE) and capillary gel electrophoresis (Fragment Analyzer, formerly Advanced Analytical, now Agilent, Santa Clara, CA), respectively ...
-
bioRxiv - Plant Biology 2024Quote: ... The same plant material was used to determine the concentrations of 11 additional mineral nutrients using the Inductively Coupled Plasma Optical Emission Spectrometer (ICP-OES) machine (19A07591, Agilent Technology Co. Ltd).
-
bioRxiv - Molecular Biology 2021Quote: ... MRI of lung was performed with a 7-T Agilent scanner (Agilent, Santa Clara, CA, USA) equipped with a DD2 console and an actively shielded gradient set (205/120 insert of maximum 130 mT m-1 gradient strength) ...
-
bioRxiv - Cancer Biology 2020Quote: TP53 IHC was performed using monoclonal anti-TP53 antibody clone DO-7 (Dako, Carpinteria, CA, USA) using standard techniques described elsewhere57 on whole BM biopsy sections in a CLIA-certified laboratory ...
-
bioRxiv - Bioengineering 2022Quote: Dynamic release was performed using the 400-DS Apparatus 7 instrument (Agilent Technologies, Santa Clara, CA) at 37 °C in a 10 mL cell ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA quality was assessed with a 2100 Bioanalyzer instrument (Agilent, RIN score ≥ 7, 28S/18S ≥ 1). RNA concentration was measured using a Nanodrop spectrophotometer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA with RNA Integrity Number (RIN) > 7 when assessed using the Agilent 2100 Bioanalyzer (Agilent, USA) were selected to move forward for further sequencing.
-
bioRxiv - Evolutionary Biology 2023Quote: ... We quantified sample RNA quantity and quality (RNA integrity number > 7) on a Tapestation 2200 (Agilent) at the University of Montana genomics core ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescent images were obtained on a Keyence BZ-X710 microscope or on a Cytation 7 (Agilent).
-
bioRxiv - Physiology 2024Quote: MRI studies were performed using a 7-T Agilent/Varian scanner (Agilent, Santa Clara, CA, USA) equipped with a DD2 console ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3′ - Diaminobenzidine (DAB+) solution (DakoCytomation, Glostrup, Denmark), and counterstained by Harris hematoxylin.
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-Krt5/6 (1:200; M7237; Agilent; Santa Clara, CA), and mouse anti-Krt14 (1:200 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antigen was retrieved using DakoCytomation target retrieval solution pH 6 (Dako). Samples were then blocked with serum-free protein block solution (Dako ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA integrity and purity were assessed by 1% agarose gel electrophoresis and analyzed on a DeNovix DS-11 spectrophotometer (DeNovix Inc., Wilmington, DE, USA) and a Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA). All samples presented standard values and RNA Integrity Number (RIN ...
-
bioRxiv - Plant Biology 2021Quote: ... One experiment was analyzed by ultra-high-performance LC (UHPLC, LC 1290 Infinity (Agilent Technologies) coupled to a HRMS (6540 UHD Accurate-Mass Q-TOF LC-MS instrument (Agilent Technologies) ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was performed using SYBR Green One-Step (Kit# 600825, Agilent, Santa Clara, CA). qRT-PCR data were analyzed using the Sequence Detection System software (SDS Version 2.2 ...
-
bioRxiv - Microbiology 2020Quote: ... One-color whole mouse (084809_D_F_20150624 slides) 60-mer oligonucleotide 8×60k v2 microarrays (Agilent Technologies) were used to analyze gene expression ...
-
bioRxiv - Plant Biology 2021Quote: ... One μl of the derivatized samples were analyzed on a Combi-PAL autosampler (Agilent Technologies) coupled to an Agilent 7890 gas chromatograph coupled to a Leco Pegasus 2 time-of-flight mass spectrometer (LECO ...
-
bioRxiv - Genetics 2022Quote: ... and in one individual by CHOP using the Agilent SureSelect Clinical Research Exome Kit (Agilent). Analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... one of the 96-well plates was evolved in the BioTek Epoch2 microplate reader (Agilent). Populations were frozen every fourth transfer and at timepoints of particular interest (e.g. ...
-
bioRxiv - Cell Biology 2023Quote: ... The virus was expanded by one round of infection of Ad-293 cells (Agilent 240085) at 5 plaque forming units (PFU ...
-
bioRxiv - Genomics 2024Quote: ... One microgram of adaptor-ligated library was hybridized using the SureSelect XT capture kit (Agilent) and our custom-designed 41K promoter Capture-C probe set31 ...
-
bioRxiv - Cancer Biology 2019Quote: MRI conducted at UT Southwestern was performed using a 7-Tesla small animal MRI system (Agilent Inc.) with a 40 mm (i.d. ...
-
bioRxiv - Cancer Biology 2019Quote: ... magnetic resonance data were acquired with a 7 T horizontal magnet Agilent ASR 310 (Agilent Technologies Inc.) equipped with nested 205/120/HDS gradient insert and a bore size of 310 mm ...
-
bioRxiv - Neuroscience 2022Quote: ... The pT7-7 plasmid was also modified using site directed mutagenesis (#200523, QuikChange II, Agilent, Waldbronn, Germany) to incorporate a cysteine residue at position 141 to permit dye-labelling of the aSyn protein ...
-
bioRxiv - Neuroscience 2023Quote: ... At day 7 of differentiation as with the mitochondrial stress test astrocytes were transferred to XFmedia (Agilent) and glycolysis was assessed ...
-
bioRxiv - Cancer Biology 2019Quote: ... 4 μg of pAAV-RC (Stratagene), and 4 μg of pHelper (Stratagene) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 4 μg of pHelper (Stratagene). The other was 1 mL of Opti-MEM plus 45 μL of Lipofectamine® 2000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×44K (G4112F, Agilent Technologies, Germany).
-
bioRxiv - Cell Biology 2022Quote: ... Insulin (Agilent, IR-002, 1:4), and Glucagon (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... and 4% normal goat serum (Dako) in PBS for 1 h at room temperature ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Genomics 2019Quote: ... The library was eluted in 11 µl ddH2O and quantitated on an Agilent TapeStation 4200 System using the High Sensitivity D1000 ScreenTape (Agilent #5067-5584 and #5067-5585).
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-human CD20 (Dako, clone L26, 1:1000, pH 6 retrieval), mouse anti-human FOXP3 (Abcam ...
-
bioRxiv - Bioengineering 2019Quote: ... Stage 6 clusters were loaded into islet capture microplates (Agilent; 101122-100) in RPMI with 2 mM glucose ...
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct ...
-
bioRxiv - Biochemistry 2023Quote: ... Antigen retrieval was performed with Citrate Buffer (pH 6) (Dako, Glostrup, Denmark). Immunohistochemical staining was performed with anti VEGFA or anti-S100A8 (Table I) ...
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...