Labshake search
Citations for Agilent :
201 - 250 of 4911 citations for 7 tert butoxycarbonyl 5 6 7 8 tetrahydro 1 2 4 triazolo 4 3 a pyrazine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Cell Biology 2022Quote: ... were diluted with ultra-pure water to reduce the acid concentration below 3% and loaded into the ICP-MS-MS (triple quad Agilent 8800x ICP-MS-MS). The instrumental conditions were optimized to remove interferences by using a collision/reaction cell ...
-
bioRxiv - Microbiology 2020Quote: ... Sections were incubated with primary antibodies for cytokeratin 7 (CK7; OV-TL 12/30,DAKO,Ready-to-Use), 3-mercaptopyruvate sulfurtransferase (MPST ...
-
bioRxiv - Genetics 2019Quote: ... and checked for a RIN number (≥ 7) to inspect RNA integrity by an Agilent Bioanalyzer 2100 (Agilent technologies). Qualified RNA was further purified by RNAClean XP Kit (Beckman Coulter ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was quantified by Qubit Fluorometer 2.0 and RNA integrity was confirmed (RIN >7) by 2100 Bioanalyzer (Agilent). Amplified cDNA libraries were constructed using SMART-seq v4 Ultra low Input RNA-kit (Takara ...
-
bioRxiv - Genomics 2021Quote: ... RNA was quantified by Qubit Fluorometer 2.0 and RNA integrity was confirmed (RIN >7) by 2100 Bioanalyzer (Agilent). RNA was amplified using NuGen Ovation RNA amplification kit and sheared to an average size of 200 bp ...
-
bioRxiv - Cancer Biology 2020Quote: ... Strand specific RNA sequencing was performed on quality controlled high RIN value (>7) RNA samples (Bioanalyzer Agilent Technologies). In brief ...
-
bioRxiv - Microbiology 2024Quote: ... Foci were manually counted from images obtained on Cytation 7 plate reader (Agilent Life Sciences, Santa Clara, CA). For mosquito infectivity ...
-
bioRxiv - Biochemistry 2019Quote: ... with a Supelco Discovery BIO wide Pore C18-3 column (4.6 x 150 mm, 3 µm particle size) using an Agilent 1260 High pressure Gradient System (Agilent, Waldbronn, Germany). The column was operated with a flow rate of 1 mL/min and performed ultrapure water with 0.1% (v/v ...
-
bioRxiv - Molecular Biology 2022Quote: ... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
bioRxiv - Cancer Biology 2022Quote: 2×104 – 4×104 cells per well were plated onto a Seahorse XFe96 FluxPak plate (Agilent, 102416-100). On the day of the assay ...
-
bioRxiv - Cell Biology 2022Quote: ... Before separation peptides were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Physiology 2021Quote: ... Peptides were first trapped (Dr. Maisch Reprosil C18, 3 μm, 2 cm × 100 μm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Cell Biology 2021Quote: ... A Ddyo7-mCherry expression plasmid was generated by first TA cloning a PCR product (myo42 to myi185+2) encompassing the myoi 3’ region of the gene (aa 475 - end) minus the stop codon using StrataClone (Agilent) (pDTi289+2) ...
-
bioRxiv - Neuroscience 2019Quote: ... Before separation peptides were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Peptides were trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) before being separated on an analytical column (Agilent Poroshell EC-C18 ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... Peptides were first trapped (Dr. Maisch Reprosil C18, 3 μm, 2 cm × 100 μm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Neuroscience 2019Quote: ... Peptides were trapped on an in house made trap column (Dr Maisch Reprosil C18 column, 3 µm, 2 cm x 100 µm) and separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Genetics 2019Quote: ... 0.3 mL of the organic layer (the lower chloroform layer) was collected into a 2 mL amber glass vial (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peptides were trapped (Dr. Maisch Reprosil C18, 3 µm, 2 cm x 100 µm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Biochemistry 2021Quote: ... 4 mL capacity (Agilent Cat. #: 5185-5991) and centrifuged at 17,172 × g for 45 min at 4 °C ...
-
bioRxiv - Genomics 2019Quote: ... Each pool of RNA was individually labelled with Cyanine-3 and Cyanine-5 (Cy3 and Cy5) using the Low input Quick Amp Labelling Kit (Agilent Technologies) followed by purification through Qiagen RNeasy Columns (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Biophysics 2023Quote: ... The cells were fixed with 3% formalin 3 days after the transfection and analyzed with the ACEA Quanteon (Agilent NovoExpresss Version 1.5.0), as described (22 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatants were fractionated on a reversed-phase Supelco Discovery BIO wide Pore C18-3 (4.6 × 150 mm, 3 µm particle size) column operated by a HPLC Agilent 1200 (Agilent Technologies, Waldbronn, Germany) chromatography system ...
-
bioRxiv - Genomics 2019Quote: ... We required a minimal RIN (RNA Integrity Number) of 7 as measured using a Bioanalyzer (Agilent, Santa Clara, CA) with the Agilent RNA 6000 Nano Kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... at a density of 7 x 105 cells per cm2 in Seahorse XF DMEM (Agilent cat. no. 103575-100) supplemented with 10mM glucose (Agilent cat ...
-
bioRxiv - Biophysics 2023Quote: ... 104 and 140) cDNA in pET-7 vector was modified by site directed mutagenesis (QuikChange Lightning kit; Agilent Technologies) to introduce one of four single cysteine mutants (T26C ...
-
bioRxiv - Physiology 2023Quote: ... RNA concentration and integrity (RIN>7 for all samples) was assessed via Qubit fluorometric quantitation and tapestation bioanalyzer (Agilent), respectively ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti-Ki-67 (Antigen Clone TEC-3) antibody (Dako), anti-Cleaved Caspase 3 (Asp175 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3+ according to the HercepTest™ Interpretation Manual (DakoCytomation).
-
bioRxiv - Immunology 2023Quote: ... the peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... Agilent Bio SEC-3 Column (Agilent Technologies, CA, USA) or HiLoad 16/60 Superdex 200 pg SEC column (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... using the Bio SEC-3 300A HPLC column (Agilent) and an isocratic elution with 100 mM ammonium acetate (pH 7.0 ...
-
bioRxiv - Immunology 2022Quote: ... Reactions were stopped by adding 50 μL 3M hydrochloric acid and absorbance at 492 nm was determined on a Synergy 4 plate reader (BioTek, Agilent Technologies inc., CA, USA) or similar ...
-
bioRxiv - Genomics 2022Quote: ... we established an automated 3’UTR-seq (QuantSeq 3’mRNA-seq; Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) at The Centre for Applied Genomics (TCAG ...
-
bioRxiv - Microbiology 2021Quote: ... All other synthetic or expressed peptide substrates were purified and analyzed at small scale utilizing analytical-scale reverse-phase HPLC on an Agilent 1100 series HPLC system (Santa Clara, CA) employing an Eclipse Plus C18 column (5 μm, 4 × 150 mm) (Agilent) at a flow rate of 1 mL/min ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Neuroscience 2023Quote: ... and β-amyloid analysis (pretreatment with formic acid, antibody 4G8, DAKO, M087201-2, 1:100, 30 minutes). Tau pathology was assessed using Braak criteria (Braak et al ...
-
bioRxiv - Bioengineering 2021Quote: ... and incubated overnight at 4 °C with primary antibodies: Anti-GFAP 1:1000 (Z0334, Dako), Anti-CD68 1:400 (MCA1957 ...
-
bioRxiv - Immunology 2019Quote: ... 4°C overnight followed by HRP conjugated goat-anti-rabbit IgG (#P0448, Dako (1:1000). α-Tubulin was used as a housekeeping control (#sc-32293 ...
-
bioRxiv - Cell Biology 2023Quote: ... membranes were washed 3 times with TBS-T and subsequently incubated with secondary antibodies (Dako, 1:5000) diluted in 5% marvel in TBS-T for 1 h at RT ...
-
bioRxiv - Cancer Biology 2021Quote: Immunohistochemical staining of formalin-fixed, paraffin-embedded xenografts was performed after antigen retrieval (120°C, 7 min at pH9) and peroxidase blocking (Dako) using the UltraVision LP detection system (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... Metabolites were analyzed on an Agilent 7890/5975C GC-MS using selected-ion monitoring methods described in previous work.7–10 Peaks were manually integrated using MSD ChemStation software (Agilent), and correction for natural isotope abundance was performed using the software Isocor (Millard et al. ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... All liver RNA samples had integrity numbers (RIN) ≥ 7 as verified with the Agilent 2100 Bioanalyser (Agilent Technologies, Waldbronn, Germany). A260/A280 were ≥ 1.8 as verified with Thermo Scientific™ NanoDrop 2000 spectrophotometer (ThermoFisher Scientific ...