Labshake search
Citations for Agilent :
101 - 150 of 1423 citations for 6H Pyrrolo 3 2 e benzothiazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Derivatized samples were run on an Agilent 7890A GC coupled to an Agilent 5975C MS and data was acquired and analyzed in MSD ChemStation E.02.02.1431 (Agilent). The GC temperature program was set to ...
-
bioRxiv - Systems Biology 2023Quote: ... The cells were plated at 15,000 cells/well onto fibronectin-coated (5 μg/cm2) xCELLigence E-plate (Agilent) wells in serum free medium ...
-
bioRxiv - Cancer Biology 2023Quote: ... 30,000 LM7 or LM7-KO cells were added to each well of a 96 well E-Plate (Agilent) in complete RPMI ...
-
bioRxiv - Plant Biology 2023Quote: ... Raw GC/MS files were exported to NetCDF format using Agilent MSD ChemStation software (Revision E.02.01.1177; Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... All tissue slices were routinely stained with hematoxylin and eosin (H&E) using the Dako Coverstainer (Agilent Technologies) and were reviewed by an experienced pathologist ...
-
bioRxiv - Microbiology 2023Quote: Cells were seeded at 3,000 cells/well in 150 μL of complete media (above) in E-plates (Agilent) and grown overnight while being monitored with an xCELLigence SP system (Agilent) ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by staining with hematoxylin and eosin (H&E) (Eosin, Dako CS701, Hematoxylin Dako S3309, bluing buffer CS702). The brightfield images were taken on a Leica DMI8 whole-slide scanner at 10x resolution.
-
bioRxiv - Biochemistry 2023Quote: ... All GFP-OGG1 proteins were expressed in BL21-CodonPlus (DE3)-RP Escherichia coli (E. coli) competent cells (Agilent). The cells were grown at 37 °C to an OD600-0.6 and OGG1 expression was induced with 0.5 mM isopropyl-b-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Bioengineering 2023Quote: ... ITO slides were then stained for H&E and imaged using the Cytation 5 (Agilent, Santa Clara, CA) and Epsilon scanner at 3000 dpi to select regions of interest using the open-source program ...
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Immunology 2021Quote: ... 96 deep well polypropylene plates (0.7 ml) with flat bottom and square wells (EK-2074, E&K Scientific; 201242-100, Agilent), or 24 well cell culture clear plates with flat bottom and circular wells (T1024 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mouse anti-E-cadherin (diluted 1:100) antibody (Ab) and anti-vimentin Ab (1:1000) were purchased from DakoCytomation, mouse anti-p65 Ab (1:500 ...
-
bioRxiv - Microbiology 2023Quote: Vero TMPRSS2 cells were plated in 96-well tissue culture treated E-Plate VIEW plates (#300-601-020, Agilent) to be subconfluent at time of assay ...
-
bioRxiv - Cancer Biology 2023Quote: All cytotoxicity assays were performed using the xCELLigence RTCA MP analyzer and 96 well PET E-plates (Agilent Technologies). Assays were carried out in RPMI containing 10% fetal calf serum ...
-
bioRxiv - Developmental Biology 2023Quote: ... Periodic acid-Schiff (PAS) and hematoxylin and eosin (H&E) staining were performed using standard procedures (Dako, Glostrup, Denmark) for the assessment of normal structures.
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3′ - Diaminobenzidine (DAB+) solution (DakoCytomation, Glostrup, Denmark), and counterstained by Harris hematoxylin.
-
bioRxiv - Developmental Biology 2023Quote: ... Sure 2 (Agilent) competent cells were transformed with the ligation product and cultured at reduced temperatures (27°C) ...
-
bioRxiv - Cell Biology 2021Quote: Microscopic observation of Arabidopsis plantlets attacked with pathogens was performed using an inverted spinning disk confocal microscope with a high-resolution camera (Yokogawa CSU-X1 on Nikon Ti-E platform, laser box Agilent MLC400 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Animals treated with CAR T cells had tumors excised and were also stained with H&E and human CD3 (A0452, Dako), in addition to GPC2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... paraffin-embedded tissue sections were dewaxed and stained according to the H/E standard protocol using a CoverStainer (Dako, Agilent).
-
bioRxiv - Cancer Biology 2022Quote: ... paraffin-embedded tissue sections were dewaxed and stained according to the H/E standard protocol using a CoverStainer (Dako, Agilent).
-
bioRxiv - Biochemistry 2022Quote: ... cholerae TrcP was sub-cloned into a custom pET vector and expressed as a 6× His-tagged N-terminal human SUMO2 fusion in E coli BL21 RIL bacteria (Agilent). A 50 ml starter culture grown overnight at 37°C in MDG medium (1.5% Bacto agar ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the sections were incubated for 1 h at room temperature with biotinylated IgG anti-mouse secondary antibody which is produced in rabbit (E 0354 -Dako Cyt ...
-
bioRxiv - Immunology 2022Quote: ... 50ul of RPMI-1640 was first added to each well of the 96-well E-plates (Agilent, Santa Clara, CA) and was measured as background impedance ...
-
bioRxiv - Immunology 2023Quote: ... sorted neutrophils were added to CMT-93 (mouse colonic epithelial cells; ATCC) monolayer on 96-well E-plate (Agilent # 300601010), and changes in TEER were measured every 15 minutes for up to 72hrs as described previously (71 ...
-
bioRxiv - Genomics 2023Quote: ... the slide was baked at 60 °C for 60 minutes and then processed through the Dako Progressive H&E protocol (Agilent) and using Dako Harris Hematoxylin ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-deoxy-d-glucose (50 mM 2-DG, Agilent Technologies) as a glycolysis inhibitor ...
-
bioRxiv - Cell Biology 2024Quote: ... 3,3’-diaminobenzidine (DAB) substrate (Agilent Cat#GV82511-2 or GV92511-2), Dako REAL Peroxidase-blocking reagent (Agilent S202386-2) ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2023Quote: ... then labeled using Cyanin-3 CTP (Agilent Technologies) and hybridized on chips containing 45000 probes (4×44K Whole Human Genome) ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm 2.7 μm HPLC column (Agilent) with a Poroshell 120 PFP ...
-
bioRxiv - Microbiology 2019Quote: ... The RNase E recognition site mutant fusions cfa’-’lacZ-LongG1 and G2 were made by mutating pCB1 using QuikChange mutagenesis (Agilent Technologies) and oligos that restore the G101C mutation to the WT and add the additional desired mutations ...
-
bioRxiv - Cancer Biology 2020Quote: ... gels were fixed in formalin prior to paraffin-embedding and staining with haematoxylin and eosin (H+E) and immunohistochemistry (IHC) for p53 (Dako IS616). Stained sections were imaged with a Pannoramic 250 scanner (3DHISTECH Ltd ...
-
bioRxiv - Biophysics 2019Quote: All plasmids for expression of MBP-5-HT3A-ICD fusion constructs with wild-type or engineered ICD were transformed into Escherichia coli (E. coli) BL21-CodonPlus-(DE3)-RIPL cells (Agilent Technologies). Cells were grown in Terrific Broth (TB ...
-
bioRxiv - Molecular Biology 2019Quote: ... We generated E-box point mutations (CANNTG ➔ CANNTA) with the QuikChange II site-directed mutagenesis kit (Agilent, 200523, Santa Clara, CA) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... All the mutants used in these cellular assays were generated by using QuikChange II-E Site-Directed Mutagenesis Kit (#200555, Agilent Technologies).
-
bioRxiv - Biochemistry 2019Quote: ... with a Supelco Discovery BIO wide Pore C18-3 column (4.6 x 150 mm, 3 µm particle size) using an Agilent 1260 High pressure Gradient System (Agilent, Waldbronn, Germany). The column was operated with a flow rate of 1 mL/min and performed ultrapure water with 0.1% (v/v ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... CD68 (Dako (M087629-2)) 1/200 ...