Labshake search
Citations for Agilent :
51 - 100 of 2210 citations for 6H Furo 2 3 g 3 benzazepine 2 ethyl 7 8 9 10 tetrahydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: After deparaffinization and antigen retrieval using Dako Target Retrieval Solution at pH 9 (S236784-2, Agilent technologies) in a water bath (96°C for 30 min) ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were centrifuged at 20.800 xg for 2 min and 100 µl sample was injected on a SEC-HPLC column (Bio SEC-3 300 Å, Agilent, USA) using an Agilent 1260 Infinity II system (Agilent ...
-
bioRxiv - Microbiology 2021Quote: ... Tissue sections were colored via DAB-staining (3, 3-diaminobenzidine; Dako, K3468).
-
bioRxiv - Microbiology 2023Quote: ... rabbit F(ab’)2 anti-human C1q-FITC (both at 5 µg/ml, Dako as described in (9)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-Diaminobenzidine (DAB, Agilent) and then counterstained with haematoxylin (Abcam) ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3×10 minutes with PBS again and mounted using glycergel (Dako, Cat.N.C0563). The imaging was performed with the use of ZEISS microscopes ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... The sections were immunostained using EnVision and ARK kits (DAKO, K400311-2 and K395411-8) according to manufacturer protocols ...
-
bioRxiv - Microbiology 2021Quote: ... 10 ng psiCHECK reporters and 2 μg pBlueScript II (Stratagene) were transfected using TransIT-293 Transfection Reagent (Mirus) ...
-
bioRxiv - Cell Biology 2023Quote: ... with approximately 10 μL of mounting media (Dako, S302380-2).
-
bioRxiv - Cancer Biology 2023Quote: ... in 3 cycles for 3 hours using the Seahorse XFe24 analyzer system (Agilent Technologies). Inhibitors and substrates were used at the following concentrations ...
-
bioRxiv - Developmental Biology 2019Quote: ... service pack 3 (Agilent Technologies).
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm column (Agilent), column temperature 50 °C ...
-
bioRxiv - Plant Biology 2020Quote: ... equipped with a 80/100 alumina column (1/8” x 2 mm x 1.5 m, Agilent) and set with the following parameters ...
-
bioRxiv - Neuroscience 2023Quote: AAV was produced by HHMI-Janelia Viral Tools using a PEI triple transfection protocol into AAV293T cells (an ITR-containing plasmid, 2/9 capsid helper from UPenn Vector Core, and the E1-deleted pHelper plasmid from Agilent). The cells were grown under serum-free conditions (three 150mm culture dishes at ∼3×107 cells/dish for each 100 µl batch) ...
-
bioRxiv - Systems Biology 2019Quote: ... An amount of 100 ng of total RNA was hybridised with Cy-3 and subsequently hybridised on microarrays (SurePrint G3 8×60K, Agilent). The raw fluorescence signals were scanned with DNA Microarray Scanner SureSelect (Agilent ...
-
bioRxiv - Cancer Biology 2019Quote: ... For 8 other samples (1 normal and 3 tumor regions each from 2 patients) only DNA was isolated and targeted panel sequencing (Agilent SureSelect run on a HiSeq) was performed for 257 genes ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Microbiology 2019Quote: ... GFAP (Dako #M076101-2 or #Z033429-2), OLIG2 (R&D Systems #AF2418 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and RNA integrity values of 9-10 (Bioanalyzer, Agilent Technologies). Gene-specific primers and dual-labelled probes (labelled with 6-carboxyfluorescein and BHQ-1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Scanning of microarrays was performed with 5 μm resolution and XDR extended range (4×44K arrays) or 3 µm resolution (8×60K arrays) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were analyzed and extracted with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Cancer Biology 2021Quote: ... Scanning of microarrays was performed with 3 μm resolution (8×60K) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were processed with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-diaminobenzidine (DAB) solution (Dako, USA) until signal was detected ...
-
bioRxiv - Cancer Biology 2022Quote: ... and KI67 (clone TEC-3, Dako) were then incubated on the tissue slices and bound antibody was detected with biotinylated goat anti-rat IgG (Southern Biotechnology) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-diaminobenzidine tetrahydrochloride (DAB; Dako, K3467), as chromogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ diaminobenzidine (DAB) (Dako, Carpinteria, CA) and counter-staining was done with hematoxylin ...
-
bioRxiv - Biochemistry 2023Quote: ... or a BIOSEC 3 column (Agilent; flow rate ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2 µg of the plasmid carrying the relevant recombinant provirus was co-transfected with 2 µg of plasmid pMD2.G (a kind gift from D. Trono) and 2 µg of plasmid PVPackgagpol (#217566 from Stratagene, La Jolla, CA) or plasmid pCMV-1′R8.74 (a gift from D ...
-
bioRxiv - Immunology 2023Quote: ... washed 3 times in PBS (10 minutes each) and mounted using Dako mounting medium (S3023; Agilent). Primary antibodies and detection reagents used ...
-
bioRxiv - Cancer Biology 2024Quote: ... The 3100 OFFGEL Fractionator and the OFFGEL Kit pH 3-10 (Agilent Technologies, Santa Clara, CA) was used following a 24-well set up ...
-
bioRxiv - Genetics 2019Quote: ... The PAM sequences in the c(3)G gene were mutated using the Quik Change II XL Site-Directed Mutagenesis Kit (Agilent Technology). The bases changed are in bold above ...
-
bioRxiv - Molecular Biology 2019Quote: ... We measured O2 consumption of fully differentiated adipocytes at day 7 with an XF24-3 extracellular flux analyzer (Agilent Technologies, Santa Clara, CA, USA). Basal respiration was also assessed in untreated cells.
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Tissue was washed 3 times with PBS (10 minutes each) and mounted in DAKO mounting medium (Agilent) containing DAPI.
-
bioRxiv - Microbiology 2021Quote: ... 50 μl of protein (10 mg/ml) were injected into a size-exclusion column (Agilent BioSec-3) equilibrated in 50 mM Tris ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3′ - Diaminobenzidine (DAB+) solution (DakoCytomation, Glostrup, Denmark), and counterstained by Harris hematoxylin.
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Genomics 2020Quote: ... a plasmid encoding the replicases of AAV serotype 2 and the capsid of AAV serotype 9) and pHelper (Agilent Technologies, lab reference pZMB0088) which provides AAV adenoviral helper functions ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sure 2 (Agilent) competent cells were transformed with the ligation product and cultured at reduced temperatures (27°C) ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids expressing gfpA206K fusions to mgrB mutants (pSY3-9, pSY72-75, pJC1-7, pTG1-15) were created by either QuikChange site-directed mutagenesis (Stratagene) or Inverse PCR [58] using pAL38 as template ...
-
bioRxiv - Genomics 2022Quote: ... Hi-C material was then amplified from the beads with 7-9 cycles of PCR using Herculase II Fusion DNA polymerase (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Purified RNA had 260/280 ratios ~2 (via Nanodrop 2000c, ThermoFischer Scientific, Waltham, MA) and RNA integrity number (RIN) scores >9 (via Bioanalyzer, Agilent Technologies, Santa Clara, CA). Human fetal cardiac fibroblasts (CFs ...