Labshake search
Citations for Agilent :
1 - 50 of 2342 citations for 6H Furo 2 3 b pyrrole 5 carboxylicacid 6 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: 2-methyl tryptophan was quantified by an LC-MS system (Agilent) using an XBridge BEH Amide 2.5 μm (Waters ...
-
bioRxiv - Molecular Biology 2024Quote: ... HP-5 MS column (5% phenyl methyl polysiloxane: 30m x 0.25mm i.d. x 0.25 µm, Agilent technologies) was used for metabolite separation ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Cell nuclei were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) for 5 min before being mounted using DAKO mounting medium (Agilent, catalog no. S302380–2). Imaging of the histological samples was performed on the Microscope Axio Imager.A2 (Carl Zeiss Microscopy ...
-
bioRxiv - Developmental Biology 2023Quote: Mouse methyl capture sequencing (Methyl-Seq) libraries were generated using the SureSelectXT Methyl-Seq Target Enrichment System (Agilent, Santa Clara, CA, USA, #G9651B) and the SureSelectXT Mouse Methyl-Seq target enrichment panel (Agilent ...
-
bioRxiv - Bioengineering 2021Quote: ... The GC-MS system used was the 7890-5975C from Agilent in combination with the HP-5MS column (5% phenyl methyl polysiloxane, 30m×0.25mm ID, 0.25µm) from Agilent. The temperature was maintained at 180 °C for 1 min ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Synthetic Biology 2023Quote: By acidic methanolysis processed PHB (3-hydroxybutyrate methyl ester) was analyzed by gas chromatography (GC 6850, Agilent Technologies, Basel, Switzerland) equipped with a 7683B Series injector coupled to a flame ionization detector (FID) ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Plant Biology 2019Quote: ... An HP-5MS capillary column (5%phenyl-methyl-siloxane, 30-m, 250-mm, and 0.25-mm film thickness; Agilent) was used with helium carrier gas at 2 mL/min ...
-
bioRxiv - Plant Biology 2021Quote: Quantitative analysis was performed using a HP-5MS capillary column (5% phenyl-methyl-siloxane, 30 m x 250 mm, 0.25 mm film thickness; Agilent) with helium carrier gas at 1.5 mL/min ...
-
bioRxiv - Molecular Biology 2020Quote: Per2AS variant 2 overexpression plasmid was generated from 5’RACE and 3’RACE products that were cloned in to pBluescript (Agilent), as well as Per2AS qPCR product cloned into pGEM-T (Promega) ...
-
bioRxiv - Cell Biology 2022Quote: ... Derivatized samples were analyzed using an Agilent Technologies 7890B gas chromatographer with a HP-5MS 5% phenyl methyl Silox column (Agilent) coupled to an Agilent Technologies 5977A mass spectrometer ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Biochemistry 2020Quote: ... were separated by a gradient elution from 5% solvent B to 95% solvent B over 15 min on a high-capacity nano-LC chip (Agilent Technologies; part no. G4240-62010) driven by a 1200 series nano-flow HPLC system (Agilent ...
-
bioRxiv - Microbiology 2019Quote: ... followed by 5 minutes of re-equilibration at 0% B (Agilent 1290 Infinity LC system). Post-column ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Physiology 2020Quote: ... Cell nuclei were counter-stained in methyl green (Dako). Specimens were then dehydrated in series of ethanol and xylene ...
-
bioRxiv - Developmental Biology 2023Quote: ... was used to produce Methyl-Seq libraries using a SureSelectXT Methyl-Seq Target Enrichment System with a mouse enrichment panel (Agilent #G9651B and #5191-6704) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: Gas chromatography was performed on an HP-5MS capillary column (5% benzene/95% methyl polysiloxane 30 m × 250 μm i.d., 0.25 μm film thickness, Agilent J & W Scientific, Folsom, CA, USA) with a constant flow of helium at 1 mL/min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Both oligo libraries (Round 5, and Round 6 + mutational scanning) were purchased from Agilent.
-
bioRxiv - Cell Biology 2022Quote: ... and SureSelectXT Mouse Methyl-Seq Reagent Kit (Agilent Catalog # 931052) ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase B consisted of acetonitrile:water 9:1 with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Genomics 2020Quote: ... As described in manufacturer’s protocol (Agilent SureSelectXT Mouse Methyl-Seq Kit), bisulfite converted libraries were PCR-amplified for 8 cycles with supplied universal primers and purified using AMPure XP beads ...
-
bioRxiv - Cell Biology 2021Quote: ... and 299.294 m/z (Methyl Stearate; Agilent article number G1982-85003) were used to recalibrate spectra during the acquisition.
-
bioRxiv - Microbiology 2021Quote: ... and analysed as fatty acid methyl esters by gas chromatography (Agilent 6890N ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Biochemistry 2022Quote: ... Sample from each PNT3 variant at 5 mg mL-1 in buffer B containing 6M GDN was injected onto an AdvanceBio SEC 2.7 µm (Agilent) SEC column ...
-
bioRxiv - Cell Biology 2019Quote: ... Fatty acid methyl esters were detected by GC-MS (Agilent 5977A-7890B) according to the method described in Ramakrishnan et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the SureSelectXT Mouse Methyl-Seq target enrichment panel (Agilent, #5191-6704) following the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2019Quote: Cleaved Caspase-3 staining required 5 minute treatment with Target Retrieval Solution (DAKO S1700), 1 hour room temperature incubation with Cleaved Caspase-3 (Asp175 ...
-
bioRxiv - Plant Biology 2021Quote: ... and 2% Buffer B (0.1% formic acid in Optima grade acetonitrile (Fisher)) using a 1200 series capillary pump (Agilent). Following loading ...
-
bioRxiv - Plant Biology 2021Quote: ... together with mass and retention time alignment (0.1 min and 5 ppm respectively) were done in Profinder B.07 software (from Agilent Technologies). Annotation was done based on the ‘find-by-formula’ algorithm ...
-
bioRxiv - Cancer Biology 2020Quote: ... Barcoded cDNA libraries containing 5-6 LMD samples plus a Universal Human Reference RNA (UHR) standard (Stratagene) were prepared on the Ion Chef System using the Ion Ampliseq Chef DL8 materials and the Ion AmpliSeq Transcriptome Human Gene Expression Panel Chef-ready Kit (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2022Quote: ... B.08.00 (Agilent Technologies, USA). A patchoulol standard (18450 ...
-
bioRxiv - Immunology 2022Quote: ... b) c-KIT− (DAKO-MA512944) (Nagasawa et al. ...
-
bioRxiv - Bioengineering 2023Quote: ... B.08.00 (Agilent Technologies, USA). The National Institute of Standards and Technology (NIST ...
-
bioRxiv - Microbiology 2019Quote: ... and 6’-Sialyllactosamine (6’SLN) (Prozyme, Hayward CA) were used to annotate HPLC peaks ...
-
bioRxiv - Cell Biology 2023Quote: ... bordered (∼ 5 x 2 cm rectangle) with a hydrophobic fat pen (Dako). A glass coverslip ...
-
bioRxiv - Developmental Biology 2020Quote: ... The following primary antibodies and dilutions were used: guinea pig anti-Insulin (1:6, Dako, IR00261-2), mouse anti-Glucagon (1:500 ...
-
bioRxiv - Biochemistry 2023Quote: ... The resulting 1-O-methyl-glycoside TMS derivatives were analysed by GC-MS (Agilent Technologies ...