Labshake search
Citations for Agilent :
251 - 300 of 2830 citations for 6H Dibenzo a g quinolizinium 5 8 13 13a tetrahydro 2 9 dihydroxy 3 10 dimethoxy 7 methyl 7S 13aS since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2019Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation ...
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Evolutionary Biology 2019Quote: ... then assessed RNA quality using TapeStation (Agilent Technologies; RIN > 7). The Genome Sequencing and Analysis Facility at the University of Texas at Austin prepared TagSeq libraries ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA integrity (RINe ≥ 7) was confirmed using Tapestation 4200 (Agilent). The median RINe score was 9.2 ...
-
bioRxiv - Biochemistry 2019Quote: ... From each sample 10 µl was injected onto a SEC-3 HPLC column (300 Å pore size; Agilent Technologies) equilibrated with HKMC at a flow rate of 0.3 ml/min ...
-
bioRxiv - Genomics 2019Quote: ... Each pool of RNA was individually labelled with Cyanine-3 and Cyanine-5 (Cy3 and Cy5) using the Low input Quick Amp Labelling Kit (Agilent Technologies) followed by purification through Qiagen RNeasy Columns (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Genomics 2022Quote: ... The bisulfite-converted library was PCR amplified and indexed using the SureSelect XT Mouse Methyl-Seq Kit (Agilent, #G9651A). Prepared libraries were run on an Illumina sequencing platform using a NextSeq High 150 bp paired-end mode.
-
bioRxiv - Cell Biology 2022Quote: ... Before separation peptides were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Physiology 2021Quote: ... Peptides were first trapped (Dr. Maisch Reprosil C18, 3 μm, 2 cm × 100 μm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Cell Biology 2021Quote: ... A Ddyo7-mCherry expression plasmid was generated by first TA cloning a PCR product (myo42 to myi185+2) encompassing the myoi 3’ region of the gene (aa 475 - end) minus the stop codon using StrataClone (Agilent) (pDTi289+2) ...
-
bioRxiv - Neuroscience 2019Quote: ... Before separation peptides were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Peptides were trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and then separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were first trapped (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) before being separated on an analytical column (Agilent Poroshell EC-C18 ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... Peptides were first trapped (Dr. Maisch Reprosil C18, 3 μm, 2 cm × 100 μm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Neuroscience 2019Quote: ... Peptides were trapped on an in house made trap column (Dr Maisch Reprosil C18 column, 3 µm, 2 cm x 100 µm) and separated on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Genetics 2019Quote: ... 0.3 mL of the organic layer (the lower chloroform layer) was collected into a 2 mL amber glass vial (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peptides were trapped (Dr. Maisch Reprosil C18, 3 µm, 2 cm x 100 µm) prior to separation on an analytical column (Agilent Poroshell EC-C18 ...
-
bioRxiv - Biochemistry 2021Quote: Fraction HMO-2 was digested by treatment of 10 µg dried sample with β-galactosidase from bovine testes (10 mU, Prozyme, Invitrogen, Karlsruhe, Germany) in 20 µl of 0.1 M citrate/phosphate buffer ...
-
bioRxiv - Neuroscience 2020Quote: RNA samples (50-100 ng) with RIN scores from 7.6 to 9 (Agilent 4200 TapeStation) were reverse transcribed to cDNA ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were treated with an antigen retrieval solution (Target Retrieval pH 9, #S2367, DAKO) for 20 min ...
-
bioRxiv - Immunology 2020Quote: ... Rehydrated sections were immersed in epitope retrieval buffer (Target Retrieval Solution, pH 9, DAKO Agilent), incubated at 97 °C for 40 min and cooled down to 65 °C using Lab vision PT module (Thermofisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... Rehydrated sections were immersed in epitope retrieval buffer (Target Retrieval Solution, pH 9, DAKO Agilent), incubated at 97 °C for 40 min and cooled down to 65 °C using Lab vision PT module (Thermofisher Scientific) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... an OD 260/280 ratio greater than 1.9 and a RIN > 9 (Agilent Bioanalyzer 2100) were chosen for cDNA library construction ...
-
bioRxiv - Bioengineering 2023Quote: ... and impedance was measured at 10 kHz every 5 min using the xCELLigence RTCA SP device (Agilent) as described above ...
-
bioRxiv - Neuroscience 2024Quote: ... sections were incubated 10 minutes in H2O2 solution (S202386-2, Agilent Technologies, Santa Clara, CA, USA) to quench endogenous peroxidases ...
-
bioRxiv - Cell Biology 2023Quote: ... at 5 mM for 2 h or by UV irradiation at 20 mJ/cm2 using Stratalinker 1800 (Stratagene) followed by 2 h incubation at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were washed 3 times 10 min in Tris-Triton Solution and mounted on gelatin-coated slides using Fluorescence Mounting Medium (Dako). Z-stack images (4 optical sections ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Cancer Biology 2022Quote: ... The HLA-I affinity chromatography was performed using a 96-well single-use micro-plate with 3 μm glass fiber and 10 μm polypropylene membranes (Agilent). Sep-Pak tC18 100 mg Sorbent 96-well plates (Waters ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were washed 3 times for 10 minutes each with TBST and probed with appropriate HRP secondary antibody (anti-Rabbit Immunoglobulin/HRP, Dako P044801 or anti-mouse Immunoglobulin/HRP ...
-
bioRxiv - Microbiology 2021Quote: ... Fatty acid methyl esters were identified by their mass spectrum and retention time and quantified by Mass Hunter Quantification Software (Agilent) and the calibration curve generated with fatty acid methyl esters standards mix (Sigma CRM47885) ...
-
bioRxiv - Genomics 2020Quote: ... The library preparations for the genome-wide data were performed according to the SureSelect XT Mouse Methyl-Seq Kit Enrichment System for Illumina Multiplexed Sequencing Library protocol (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... The extracted phospholipids were methanolized as fatty-acid methyl esters and then analysed using gas chromatography (Agilent Technologies 6890N, UK) [26] ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary antibodies were mouse anti-Cytokeratin 7 (DAKO - M7018, 1:400), Rabbit anti-Cytokeratin 20 (Abcam - ab76126 ...
-
bioRxiv - Neuroscience 2021Quote: ... Images were acquired on a 7 Tesla MRI scanner (Agilent Inc.) (23 ...
-
bioRxiv - Immunology 2023Quote: ... or R-phycoerythrin-cyanine-7 (PE-Cy7) fluorochromes (Prozyme, Thermo-Fisher).
-
bioRxiv - Plant Biology 2021Quote: ... All samples were loaded into a 10 cm capillary column packed with 5 μM Zorbax SB-C18 (Agilent) and then connected to a 5 cm-long strong cationic exchange (SCX ...
-
bioRxiv - Plant Biology 2022Quote: ... All samples were loaded into a 10 cm capillary column packed with 5 μM Zorbax SB-C18 (Agilent) and then connected to a 5 cm-long strong cationic exchange (SCX ...
-
bioRxiv - Microbiology 2022Quote: ... injection volume 5-10 μL and data was collected in centroid mode with Mass Hunter Workstation software (Agilent). Raw Agilent.d files were converted to mzXML with MSconvert and analysed using the Maven software package (84) ...
-
bioRxiv - Bioengineering 2022Quote: ... Samples of labeled and unlabeled antibody (5 – 10 μg) were run on a HPLC (Agilent 1260 Infinity II) using an Agilent AdvanceBIO SEC 300Å 2.7 mm column (PL1580-3301 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Some of them were subjected to further purification using semipreparative techniques (Agilent, C18, 5 μm, 250 × 10 mm) using appropriately selected aqueous AcN or MeOH solvent systems.
-
bioRxiv - Immunology 2021Quote: ... Slides were incubated at 95°C for 30 minutes in Antigen Retrieval Solution (pH 9) (Dako), cooled down at RT and rinsed in TBS ...
-
bioRxiv - Immunology 2022Quote: ... Tissues next underwent antigen retrieval by submerging slides in Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97ºC for 40 min and cooled down to 65ºC in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... Tissues next underwent antigen retrieval by submerging slides in Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97ºC for 40 min and cooled down to 65ºC in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... were used with the Dako High pH Target Retrieval Solution (Tris/EDTA, pH 9; Agilent, USA) (20 minutes ...