Labshake search
Citations for Agilent :
451 - 500 of 3646 citations for 6H 1 3 5 Trioxepino 6 7 f benzimidazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... For immunohistochemistry the antibodies detailed in follow were used: AE1/3 (Dako/IR053), TTF-1 (Dako/IR056) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... For separation a Zorbax RRHD Eclipse XDB C18 column (1.8µm, 3×50mm; Agilent) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3×10 minutes with PBS again and mounted using glycergel (Dako, Cat.N.C0563). The imaging was performed with the use of ZEISS microscopes ...
-
bioRxiv - Molecular Biology 2024Quote: ... in PBST for 1 h at RT Sections were incubated overnight at RT in primary antibody rabbit anti-GFAP (Agilent, Dako Z0334,1:500 in 5 % NGS-PBST) and then with biotinylated secondary antibody anti-rabbit IgG (H+L ...
-
bioRxiv - Bioengineering 2019Quote: ... The electrical state was tested with a resistance meter (34401A 6 ½ Digit Multimeter, Agilent, Santa Clara, CA, USA) between different tapping points (connector – solder pads on interconnecting ceramic – wires anterior to interconnecting ceramic) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... (Mildford, MA, USA) and vacuum manifold system (VacElut 6 Manifold Processing Station, Agilent Technologies, Santa Clara, CA, USA) were used for solid-phase extraction (SPE).
-
bioRxiv - Microbiology 2020Quote: ... The plasmid for production of (His)6-SUMO-σAntA-DD was generated by site-directed mutagenesis (Agilent QuikChange) using primers listed in Table S3 ...
-
bioRxiv - Biochemistry 2022Quote: ... MNase-digested samples were loaded on 6% PAGE and stained with SybrGOLD and run on a Bioanalyzer (Agilent) using DNA High sensitivity chips ...
-
bioRxiv - Molecular Biology 2023Quote: ... serotype 6 (AAV6) vector plasmids were cloned into the pAAV-MCS plasmid (Agilent Technologies, Santa Clara, CA, USA), comprised of inverted terminal repeats (ITRs ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA-resistant versions have been obtained by mutating 6 bp of the siRNA-targeting sequence using Quickchange (Agilent).
-
bioRxiv - Cancer Biology 2023Quote: ... The slides were steamed for 35 minutes with a pH 6 Dako Target Retrieval (Agilent Technologies, S169984-2) and permeabilized with 0.1% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... was heated to 40°C for an isocratic 6-minute run paired with a 5977B GC/MSD (Agilent).
-
bioRxiv - Genetics 2024Quote: ... serotype 6 (AAV6) vector plasmids were cloned into the pAAV-MCS plasmid (Agilent Technologies, Santa Clara, CA, USA), comprised of inverted terminal repeats (ITRs ...
-
bioRxiv - Cell Biology 2020Quote: ... A 140 bp region of alpha satellite sequence from chromosome 4 and a 349 bp region of HSATII from chromosome 7 were independently cloned into pTargeT™ DNA backbone via StrataClone TA cloning (Agilent Technologies, Santa Clara, CA).
-
bioRxiv - Biochemistry 2020Quote: The rate of debenzylation of 7-benzyloxyquinoline was measured with a real-time continuous fluorometric assay using a Cary Eclipse fluorometer (Agilent Technologies, Santa Clara, CA, USA) or a custom-modified PTI QM-1 fluorometer (Photon Technology International ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Generated tryptic peptides were loaded onto a trap column (300SB-C18, 5 × 0.3 mm, 5-μm particle size; Agilent Technologies, Santa Clara, CA, USA) connected through a zero-dead-volume union to the self-packed analytical column (C18 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Plant Biology 2019Quote: ... using a J&W DB-5 MS column (Agilent Technologies) with the oven program ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Molecular Biology 2024Quote: ... in PBST for 1 h at RT Sections were incubated overnight at RT in primary antibody rabbit anti-GFAP (Agilent, Dako Z0334,1:500 in 5 % NGS-PBST) and then with biotinylated secondary antibody anti-rabbit IgG (H+L ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoreactions were visualized using 3-amino-9-ethylcarbazole containing hydrogen peroxide (DAKO, Tokyo, Japan).
-
bioRxiv - Cell Biology 2022Quote: ... 3 μl of cell suspension were mixed with 10ul of fluorescence mounting medium (Dako) and mounted for downstream confocal imaging ...
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Carpinteria, CA, USA). The sections were counterstained with Mayer’s haematoxylin and coverslipped ...
-
bioRxiv - Biochemistry 2021Quote: pGEX4T-3 expression plasmids were transformed into BL21-Codon Plus RIPL competent cells (Agilent). Protein expression was induced at 20°C for 3.5 hr ...
-
bioRxiv - Genetics 2021Quote: ... Products were visualized on a 3% TAE agarose gel and quantified by TapeStation (Agilent).
-
bioRxiv - Biochemistry 2021Quote: ... The purified S protein was separated by an SEC column (BioSEC-3, Agilent, USA) connected to an HPLC system (Analytical HPLC 1260 LC system ...
-
bioRxiv - Neuroscience 2023Quote: ... Fluorescence of plasma samples was directly measured using a Take 3 Microvolume Plate (Agilent), measured using an Agilent Cytation 7 (Excitation ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were washed 3 times with 100 µL of XF Base Media (Seahorse Bioscience) containing 2 mM L-Glutamine ...
-
bioRxiv - Microbiology 2023Quote: ... HT29 SGG UCN34 (n=3) were checked on RNA 6000 Nano chips (Bioanalyzer, Agilent) for quality and integrity ...
-
bioRxiv - Immunology 2023Quote: ... and rabbit polyclonal antibodies against CD-3 protein (Dako, Glostrup, Denmark; cat. no. A0452).
-
bioRxiv - Physiology 2023Quote: ... Plates were read according to manufacturer’s instructions using the Cytation 3 plate reader (Agilent) with Gen5 software (v2.04).
-
bioRxiv - Cancer Biology 2023Quote: ... Endogenous peroxidase activity was blocked with 3 % hydrogen peroxidase solution (Dako, S2023, CA, USA) for 5 min ...
-
bioRxiv - Biochemistry 2023Quote: ... or on a Poroshell 120 EC-C18 (Agilent, 3 x 150 mm, 2.7 µm) reversed phase column ...
-
bioRxiv - Plant Biology 2020Quote: ... from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6). For expression analysis in control conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... paraffin embedded TMA slides were processed for antigen retrieval for 15 minutes performed using TAR buffer pH 6 (Dako) in a steamer ...
-
bioRxiv - Molecular Biology 2022Quote: ... Embedded tissue sections were pre-treated with a heat induced epitope retrieval (HIER) method (pH 6, DAKO, Hamburg, Germany). As secondary antibody anti-rabbit Polymer-AP (Enzo Life Sciences ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were incubated for 5 minutes with DAPI (4’, 6-diamidino-2-phenylindole, 0.5ug/mL in 1X PBS) and were mounted using fluorescence mounting medium (Dako). Negative controls were included in each batch by omitting the primary antibody.
-
bioRxiv - Bioengineering 2022Quote: ... Freshly prepared sample (6 μL) was injected on an ZORBAX SB-Aq column (Agilent, 4.6 × 100 mm, 3.5 μm). The column temperature was set to 45 °C ...
-
bioRxiv - Immunology 2021Quote: ... 10μM ADP or 1μM TRAP-6 in the presence of fluorescein isothiocyanate–conjugated polyclonal rabbit anti-fibrinogen antibody (Agilent Technologies LDA UK Limited ...
-
bioRxiv - Cell Biology 2020Quote: ... Amplified cDNA sequences were modified and cloned into BamHI and XhoI sites of pCMV-3FLAG-6 vector (Agilent, 240200). To produce shRNA lentivirus particles ...
-
bioRxiv - Neuroscience 2023Quote: ... plated 3µg/50µl/well onto a 96 well plate with all animals having 6-8 technical replicates (101085-004, Agilent). Mitochondrial-plates were then centrifuged at 2000g ...
-
bioRxiv - Neuroscience 2023Quote: AAV plasmids carrying cDNA for hIL-6 downstream of a CMV promoter were co-transfected with pAAV-RC (Stratagene) encoding the AAV genes rep and cap ...