Labshake search
Citations for Agilent :
551 - 600 of 4015 citations for 6H 1 2 Thiazine 6 ethoxy 5 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6). For expression analysis in control conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... paraffin embedded TMA slides were processed for antigen retrieval for 15 minutes performed using TAR buffer pH 6 (Dako) in a steamer ...
-
bioRxiv - Molecular Biology 2022Quote: ... Embedded tissue sections were pre-treated with a heat induced epitope retrieval (HIER) method (pH 6, DAKO, Hamburg, Germany). As secondary antibody anti-rabbit Polymer-AP (Enzo Life Sciences ...
-
bioRxiv - Bioengineering 2022Quote: ... Freshly prepared sample (6 μL) was injected on an ZORBAX SB-Aq column (Agilent, 4.6 × 100 mm, 3.5 μm). The column temperature was set to 45 °C ...
-
bioRxiv - Immunology 2021Quote: ... 10μM ADP or 1μM TRAP-6 in the presence of fluorescein isothiocyanate–conjugated polyclonal rabbit anti-fibrinogen antibody (Agilent Technologies LDA UK Limited ...
-
bioRxiv - Cell Biology 2020Quote: ... Amplified cDNA sequences were modified and cloned into BamHI and XhoI sites of pCMV-3FLAG-6 vector (Agilent, 240200). To produce shRNA lentivirus particles ...
-
bioRxiv - Neuroscience 2023Quote: ... plated 3µg/50µl/well onto a 96 well plate with all animals having 6-8 technical replicates (101085-004, Agilent). Mitochondrial-plates were then centrifuged at 2000g ...
-
bioRxiv - Neuroscience 2023Quote: AAV plasmids carrying cDNA for hIL-6 downstream of a CMV promoter were co-transfected with pAAV-RC (Stratagene) encoding the AAV genes rep and cap ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Developmental Biology 2023Quote: ... membranes were incubated for 1 h at room temperature with polyclonal goat anti-rabbit secondary antibody IgG/HRP (P044801-2; Agilent Technologies/Dako, Santa Clara, 527 CA, United States) diluted 1:2000 in milk ...
-
bioRxiv - Neuroscience 2024Quote: ... The cells were washed once with DMEM Assay Medium (XF DMEM [Agilent] supplemented with XF glucose [10 mM, Agilent], XF glutamine [2 mM, Agilent] and XF pyruvate [1 mM, Agilent]), then left in DMEM Assay Medium and placed in a non-CO2 incubator for 1 hour ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tissue sections were then incubated overnight at 4°C with primary antibodies (Extended Table 2) in Antibody Diluent (Agilent Dako, S080983-2). Following a wash step ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tissue sections were then incubated overnight at 4°C with primary antibodies (Extended Table 2) in Antibody Diluent (Agilent Dako, S080983-2). Following a wash step ...
-
bioRxiv - Neuroscience 2022Quote: ... with ODS column (2 x 50 mm, 2 μm) coupled to Agilent LC/MSD TOF MS system (Agilent Technologies Inc, Wadbronn, Germany). For chromatographic separation ...
-
bioRxiv - Neuroscience 2022Quote: ... Rat GluN2B-G689C-C1/2 and Rat GluN2B-G689S-C1/2 were generated using the QuikChange Site-Directed Mutagenesis Kit (Agilent,Cat. # 200518). Primers for GluN2B-G689C Mutagenesis ...
-
bioRxiv - Cancer Biology 2021Quote: Antibodies were diluted in antibody diluent (Dako, S302281-2). Nuclei were visualized by DAPI (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... and blocked with Protein-Block reagent (Dako, X090930-2) at room temperature for 30 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... rinsed three times in wash buffer (Dako, K800721-2), and blocked with 5% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μl of sample was subjected to TapeStation (Agilent) analysis to ascertain band sizes ...
-
bioRxiv - Cancer Biology 2019Quote: ... and transformed into electrocompetent SURE 2 cells (Agilent, #200152). Transformants were inoculated into 500 ml of 2xYT media containing 100 μg/ml carbenicillin and incubated overnight at 37°C ...
-
bioRxiv - Immunology 2019Quote: ... and rabbit anti-human myeloperoxidase (A039829-2, Dako, USA) at 1:300 ...
-
bioRxiv - Biochemistry 2020Quote: ... or anti-rabbit-HRP conjugate (Agilent Dako P044801-2) and visualized with Western Blotting Luminol Reagent (Santa Cruz Biotechnology sc-2048 ...
-
bioRxiv - Biochemistry 2020Quote: ... or anti-rabbit-HRP conjugate (Agilent Dako P044801-2) and visualized with Western Blotting Luminol Reagent (Santa Cruz Biotechnology sc-2048 ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were mounted in Glycergel (Agilent Dako, C056330-2) and observed using a Nikon Eclipse 80i epifluorescence microscope (Nikon Instruments ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were mounted in Glycergel (Agilent Dako, C056330-2) and observed using a Nikon Eclipse 80i epifluorescence microscope (Nikon Instruments ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) was used to wash slides followed by treatment with Peroxidazed 1 (Biocare Medical ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) was used to wash slides followed by treatment with Peroxidazed 1 (Biocare Medical ...
-
HNRNPA2B1 controls an unfolded protein response-related prognostic gene signature in prostate cancerbioRxiv - Cancer Biology 2022Quote: ... and anti-rabbit IgG HRP-linked (P044801-2, Dako). The IRE1 inhibitor STF083010 was purchased from Merck Life Science ...
-
bioRxiv - Bioengineering 2022Quote: ... collagen type IV (2 μg /ml clone M0785, Dako, Agilent Pathology Solutions ...
-
bioRxiv - Cancer Biology 2022Quote: ... For detection the EnVision detection system (K500711-2, Dako) was used.
-
bioRxiv - Molecular Biology 2019Quote: ... and UV-crosslinked (2×2400 μJoules, Stratagene UV crosslinker) in two P15 Petri dishes on ice ...
-
bioRxiv - Cancer Biology 2020Quote: ... EnVision+ Dual Link HRP secondary (Agilent, Cat#K406311-2), and the ImmPACT DAB Peroxidase (HRP ...
-
bioRxiv - Microbiology 2021Quote: ... anti-MPO (A039829-2, DAKO; Agilent Santa clara, CA) or anti-Iba1 (019-19741 ...
-
bioRxiv - Microbiology 2021Quote: ... anti-MPO (A039829-2, DAKO; Agilent Santa clara, CA) or anti-Iba1 (019-19741 ...
-
bioRxiv - Neuroscience 2021Quote: ... XL-2 Blue ultracompetent bacterial cells (#200150, Agilent Technologies) were subsequently transformed with the ligation mixture and the resulting bacterial cell clones were screened by PCR ...
-
bioRxiv - Cancer Biology 2020Quote: ... and mouse monoclonal anti-α-SMA (M085129-2, Dako), Secondary antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were treated by Bluing Buffer (Agilent, CS70230-2) at RT for 2 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 2 mM Seahorse XF Glutamine Solution (Agilent) at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a 30-minute protein block (Dako, X090930-2) before incubating with H3K36me3 primary antibody (Abcam ...
-
bioRxiv - Cancer Biology 2022Quote: ... rabbit anti-mouse IgG HRP (Agilent technologies/P044701-2), goat anti-rat IgG HRP (Abcam/ab57057 ...
-
bioRxiv - Microbiology 2023Quote: ... Antibody diluent (Agilent, Santa Clara, CA, USA, # S302283-2) was used as a negative reagent control to replace the primary antibodies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sections were treated with Protein Block (Dako, #X090930-2) then incubated with primary F4/80 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) was used to wash slides followed by treatment with Peroxidazed 1 (Biocare Medical ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1X EnVision FLEX Wash Buffer (Agilent DAKO, K800721-2) was used to wash slides followed by treatment with Peroxidazed 1 (Biocare Medical ...
-
bioRxiv - Genomics 2022Quote: ... 75µL of Dako Bluing Buffer (Agilent Technologies, CS70230-2) was added to each tissue section well ...
-
bioRxiv - Cell Biology 2023Quote: ... Horseradish Peroxidase-conjugated Goat Anti-Rabbit (Dako P044801-2) and Rabbit Anti-Mouse (Dako P044701-5 ...
-
bioRxiv - Genetics 2023Quote: ... in 2 ml glass vials (Agilent Technologies, Waldbronn, Germany) on an orbital shaker (IKA KS 130 Basic ...
-
bioRxiv - Developmental Biology 2023Quote: ... and mounted with Dako mounting medium (#S302380-2, Agilent). The following primary antibodies were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM l-glutamine (Agilent Technologies, Cat. 103579-100) and 1mM pyruvate (Agilent Technologies ...
-
bioRxiv - Neuroscience 2023Quote: ... with DAKO Fluorescent Mounting Medium (Agilent, cat. #S302380-2).