Labshake search
Citations for Agilent :
101 - 150 of 243 citations for 6 n Hexylaminopurine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... These pUAST-(G4C2)n vectors were amplified with a recombinase-mutated SURE®2 Escherichia coli strain (Agilent Technologies) at 28 °C for 72 hours to prevent repeat length contraction ...
-
bioRxiv - Bioengineering 2023Quote: ... After calibrating and verifying the performance of the column using the LC Bio-standard (Agilent, P/N : 5190-9417), the recombinant antibody samples were diluted to 2mg/ml in 1XPBS and loaded onto a pre-conditioned column at a flow rate of 0.35ml/min ...
-
bioRxiv - Immunology 2023Quote: ZIKV NS2B-NS3pro recombinant constructs with N-terminal His tag were used to transform competent E.coli BL21 (DE3) Codon Plus cells (Stratagene). Transformed cells were grown at 30°C in LB broth containing carbenicillin (0.1 mg/ml) ...
-
bioRxiv - Biochemistry 2021Quote: ... tissue sections were deparaffinized and permeabilized by citrate buffer (pH 6) for 25 min (Dako). Slices were blocked with 5% donkey serum (37°C ...
-
bioRxiv - Immunology 2020Quote: ... cDNA for Sp110 CARD (aa 6-110) were amplified from MegaMan Human Transcriptome Library (Stratagene). cDNA for the tandem SUMO interaction motifs of RNF4 (aa 38-129 ...
-
bioRxiv - Genetics 2019Quote: ... slides were incubated in antigen retrieval solution (Target Retrieval Solution Citrate pH 6; Dako cytomation) at 98°C for 20 minutes and then cooled at room temperature for 20 minutes ...
-
bioRxiv - Neuroscience 2019Quote: ... or hIL-6 downstream of a CMV promoter were co-transfected with pAAV-RC (Stratagene) encoding the AAV genes rep and cap ...
-
bioRxiv - Microbiology 2023Quote: ... using an ion-exchange column (Agilent Hi-Plex H, 300 × 7.7 mm, 6 μm I.D.) with isocratic elution using 5 mM H2SO4 at 50 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were then microwaved in the presence of DakoCytomation target retrieval solution pH 6 (Dako). Slides were incubated with 0.3% hydrogen peroxide solution in methanol for 15 minutes at room temperature to inhibit internal peroxide activity ...
-
bioRxiv - Biophysics 2021Quote: ... The plasmid encoding the protein fused with a His-tag at the N-terminus was transformed in BL21 DE3 pLysS strains (Agilent). Recombinant αE-catenin was expressed via isopropyl 1-thio-β-d-galactopyranoside (IPTG,Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... analysis of intact N-glycans was performed using 2-aminobenzamide (2-AB) labeling and separation on a Zorbax NH2 column (Agilent), essentially as described elsewhere [11 ...
-
bioRxiv - Evolutionary Biology 2020Quote: A mutant version of hA5 with a single N-terminal Cys residues were generated via sitedirected mutagenesis using the QuikChange lightning system (Agilent). The Cys was introduced in the Ser-Asn tag leftover from TEV protease cleavage as Ser-Asn-Cys ...
-
bioRxiv - Biochemistry 2021Quote: Rat Kir6.1 and N-terminal FLAG-tagged (DYKDDDDK) SUR2B were first cloned into pShuttle vectors and then the AdEasy vector (Stratagene), and packaged into recombinant adenoviruses in HEK293 cells according to manufacturer’s instructions63,64 ...
-
bioRxiv - Biochemistry 2021Quote: Tpm isoforms Tpm1.6 and Tpm3.1 (with and without Met-Ala-Ser at the N-terminus) were expressed in ArcticExpress(DE3) RIL cells (Agilent Technologies), grown in Terrific Broth (TB ...
-
bioRxiv - Biochemistry 2020Quote: ... Salmonella typhimurium MsbA (T561C in a C88A/C315A cysteine-less background) with an N-terminal poly-histidine-tag was expressed in BL21-CodonPlus (DE3)-RIPL (Agilent). Expression was induced with 1 mM IPTG for 4 hours at 30°C and membrane proteins were solubilized with 1% DDM and 0.04% sodium cholate in a buffer containing 100 mM NaCl ...
-
bioRxiv - Microbiology 2020Quote: ... 500 μl of culture headspace was sampled via gas-tight syringe and subject to gas chromatography through a HayeSep N column (Agilent) at 90°C in N2 carrier gas ...
-
bioRxiv - Biophysics 2021Quote: hnRNPA1* (where * denotes that the hexa-peptide 259-264 is deleted) protein and deletion constructs were expressed as N-terminally tagged hSUMO fusion proteins in BL21 (DE3) RIPL cells (Agilent) in LB media ...
-
bioRxiv - Biochemistry 2022Quote: ... or a FLAG tag (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) was added on the N-terminus of MBP WT or R919* TRPA1 using Quikchange Lightning site-directed mutagenesis (Agilent).
-
bioRxiv - Neuroscience 2021Quote: ... TDP-43N-Del was generated by deletion of the first 81 amino acids from the N-terminus of TDP-43WT using the QuickChange Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Microbiology 2019Quote: ... Dried FAMES were redissolved in n-hexane and then quantified by gas chromatography (N6890, Agilent Technologies, Santa Clara, CA, USA) and identified with a MIDI Sherlock microbial identification system version 4.5 (MIDI Inc. ...
-
bioRxiv - Molecular Biology 2020Quote: ... NOCT N-terminal point mutants were generated from pCR4 TOPO NOCT (Open Biosystems) and Quikchange site directed mutagenesis PCR (Agilent) to generate NOCT(1-431 ...
-
bioRxiv - Biochemistry 2019Quote: ... vector encoding the pG gene as reported previously26 was site-specifically mutated by the insertion of an N-terminal serine using the QuikChange Lightning Multi Site-Directed Mutagenesis kit (Agilent), according to the manufacturer’s instructions using following forward and reverse primers (ser codon underlined) ...
-
bioRxiv - Microbiology 2019Quote: ... a BglII restriction site within the linker-sequence separating the N-terminal mCherry-tag from hGBP1 was eliminated in pmCherry-hGBP1 by Quickchange Site Directed Mutagenesis (Agilent) using the oligomer pair pmCherry-hGBP1DBglII-F and -R (Table S9) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6XHis tag was added to the N-terminus of Upf1 in pGEM-3Zf (+) using QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) with oligonucleotides 5-N-His-UPF1 and 5-N-HIS-UPF1-r to yield pGEM3Zf(+)-6XHis-UPF1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... GC-MS analysis was performed using an Agilent 8860 GC system equipped with an Agilent 7683 N auto sampler and a Agilent J & W GC columns (30 m × 0.25 mm × 0.2 μm, Agilent technologies USA). The injector was set at 220 °C and 1 μL injections were made with helium as carrier gas ...
-
bioRxiv - Microbiology 2022Quote: ... The copies of expressed hACE2 or SARS-CoV-2 N gene copies in individual tissues were interpolated based on threshold cycle (Ct) values determined using MxPro qPCR software (Agilent). A value of 1 was assigned if gene copies were below the detection limits.
-
bioRxiv - Plant Biology 2022Quote: Carotenoids and chlorophyll analysis was performed on one leaf per plant (n=10) using high-performance liquid chromatography (HPLC) (Agilent 1260 Infinity ...
-
bioRxiv - Molecular Biology 2023Quote: ... each reaction was diluted with 100μl 2X SSC and slot blotted using Bio-Rad Slot blot apparatus onto Hybond-N+ membranes (Amersham) which were UV crosslinked with autocrosslink settings (120mJ/cm2) of Stratalinker 1800 (Stratagene) apparatus ...
-
bioRxiv - Plant Biology 2023Quote: PHDsuper-FN3VRN5 from Zm for XL-MS analysis was inserted into pEC-LIC-His-3C containing a hexa-histidine tag and 3C protease cleavage site at the N terminus and was expressed in BL21 CodonPlus (DE3)-RIL cells (Agilent) in LB medium ...
-
bioRxiv - Immunology 2023Quote: ... analysis of intact N-glycans was performed using 2-aminobenzamide (2-AB) labeling and separation on a Zorbax NH2 column (Agilent), essentially as described elsewhere (Bigge ...
-
bioRxiv - Plant Biology 2023Quote: ... 5989-8310EN (Agilent G1676AA Agilent Fiehn GC/MS Metabolomics RTL Library User Guide. June 2008. Agilent P/N: G1676-90000, Agilent Fiehn GC/MS Metabolomics RTL Library Product Note ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3.1zeo+/ nFlag-cmScarlet-hRobo1 was generated by inserting the Flag tag sequence at the N-terminus after the signal peptide sequence of Robo1 with QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Biochemistry 2024Quote: Genes encoding rat Kir6.2Q52R and N-terminal FLAG-tagged (DYKDDDDK) hamster SUR1 were cloned into pShuttle vectors and then the AdEasy vector (Stratagene), and packaged into recombinant adenoviruses ...
-
bioRxiv - Cancer Biology 2020Quote: ... Slides were microwaved in pH 6 antigen retrieval solution (1X Target Retrieval Solution, Agilent Cat # S1699) to bring near to ...
-
bioRxiv - Genomics 2020Quote: ... Adapter-ligated DNA was amplified for 6-8 cycles using Herc II Fusion DNA polymerase (Agilent). PCR products were purified with AMPure XP beads and subjected to Illumina paired-end sequencing (2x 75 bp).
-
bioRxiv - Physiology 2021Quote: HUVECs (passages 4-6) were seeded in XFe 24 well plates (Agilent, Santa Clara, CA, USA) at 30,000 cells per well in 200 µL EGM for 48 h ...
-
bioRxiv - Immunology 2023Quote: ... Heat-induced epitope retrieval was performed for 15 min in Target Retrieval solution (pH 6) (Dako) and all other steps were as described above for mouse snout processing ...
-
bioRxiv - Immunology 2024Quote: ... Antigen retrieval was performed using Antigen Retrieval Solution (pH 6 or pH 9) (Dako, Glostrup, Denmark) for at least 15 minutes in an autoclave ...
-
bioRxiv - Cell Biology 2022Quote: ... All mutations and the addition of the Myc-tag to the N-terminus of α-PheRS were made by following the procedure of the QuickChange Site-Directed Mutagenesis Kit (Stratagene). The genomic α-PheRS rescue construct (Myc::α-PheRS ...
-
bioRxiv - Biophysics 2020Quote: ... Human SHP-1 with an N-terminal 6x His tag was produced in Escherichia coli BL21-CodonPlus (DE3)-RIPL strain (Agilent Technologies) and purified on Ni2+-NTA agarose (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: Fatty acid methyl esters were obtained as previously described [17] and separated by using a gas chromatograph (model 6890 N; Agilent Technologies). Peaks were automatically computed and assigned using the Microbial Identification software package (MIDI) ...
-
bioRxiv - Evolutionary Biology 2022Quote: Telomeric (TTAGGG)n repeats were detected by FISH using a commercial telomere PNA probe directly labelled with Cy3 (DAKO, Glostrup, Denmark) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Glutathione S-transferase (GST) hERG1a N-terminal domains or GST-only negative controls constructs were grown in BL21 (DE3) competent cells (Agilent Technologies) until they reached exponential growth ...
-
bioRxiv - Molecular Biology 2021Quote: The hydrophobic residues Phe5 and Leu7 in LepB TMH1 were replaced with arginine (R) in construct N = 55 by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden). Multiple alanine substitutions (underlined ...
-
bioRxiv - Molecular Biology 2021Quote: ... Single alanine substitutions of Cys171 and Cys177 in construct N = 223 were made by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden).
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence was mutagenized to obtain the N-ter tag canonical variant 2 through the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521) using the following DNA primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Molecular Biology 2023Quote: ... desorption was performed at 250°C for 1’ (splitless mode) in the injection port of a 6890 N gas chromatograph (Agilent Technologies) coupled to a 5975B mass spectrometer (Agilent Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).