Labshake search
Citations for Agilent :
601 - 650 of 802 citations for 6 fluoro 5 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... 10 μg of TMT-labeled peptides were loaded onto 10 cm capillary columns packed with 5 μM Zorbax SB-C18 (Agilent), which was connected using a zero dead volume 1 μm filter (Upchurch ...
-
bioRxiv - Developmental Biology 2023Quote: ... with a KpnI site inserted at the 5’ end of Δ3-1 or Δ3-2 (Quick Change Site-Directed Mutagenesis from Stratagene) using the oligonucleotides Δ3-1-KpnI Fw ...
-
bioRxiv - Neuroscience 2023Quote: Sound stimuli consisted in single-cycle sound pips (5-ms duration at 200 Hz) produced by a function generator (33210A Agilent Technologies Inc. ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were then transferred immediately into a 5 mm NMR tube (Wilmad) and placed into a 600 MHz magnet with a coldprobe (Agilent). The peptide backbone was assigned using a combination of BEST versions of 3D HNCA ...
-
bioRxiv - Biochemistry 2023Quote: ... 10μL of purified protein was injected to a C-18 column (Agilent Zorbax 300SB-C18, 5 μM, 2.1 x 150mm) without dilution or buffer exchange ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were washed three times with 1x PBST for 5 min and incubated with secondary antibodies anti-mouse-HRP (1:10,000) (Agilent Dako, #P0447) and anti-rabbit-HRP (1:10,000 ...
-
bioRxiv - Microbiology 2023Quote: BAs in liver tissue and cecum content were extracted with methanol and 5 μL was injected onto a reverse-phased chromatography (1290 Infinity II, Agilent) and mass spectrometer (6546 Q-TOF/MS ...
-
bioRxiv - Biochemistry 2023Quote: ... The filtrate was injected into a C18 reversed-phase column (4.6 mm×150 mm, 5 μm particle size, Agilent, USA) in a Thermo-Fisher Ultimate 3000 separation module equipped with a DAD-3000 Diode Array Detector ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Five μL of analyte was applied to an Eclipse XDB-C18 column (150 x 4.6 mm, 5 μm, Agilent Technologies) and separated using the following gradient at 1 mL/min ...
-
bioRxiv - Biochemistry 2023Quote: ... Online HPLC was performed on a U3000 RSLC nano Pro-flow system using a C3 column (Zorbax 300SB-C3, 5 µm; Agilent). Samples were maintained at 4 °C and 1 µL injected for each analysis using a microliter pickup ...
-
bioRxiv - Systems Biology 2023Quote: ... the peptides were reconstituted in 10 mM TEAB and fractionated using a bRPLC column (Agilent 300 Extend-C18 column, 5 µm, 4.6 mm × 250 mm, Agilent Technologies) under an increasing gradient of the mobile phases consisting of 10 mM TEAB in water and 90% acetonitrile (ACN) ...
-
bioRxiv - Developmental Biology 2024Quote: Amplicons per sample were pooled to a maximum concentration of 5 ng/µl and assessed for DNA quality using a fragment analyzer (Agilent) and the Qubit™ dsDNA HS Assay kit (Invitrogen ...
-
bioRxiv - Systems Biology 2024Quote: ... elav (Developmental Studies Hybridoma Bank, 9F8A9 at 1:20 and 7E8A10 at 1:5) and PCNA (DAKO, MO879, 1:500). For immunofluorescence studies ...
-
bioRxiv - Neuroscience 2023Quote: ... the incubation time for oligomycin during the assay was increased to 15 min to allow for proper diffusion into the slices and the final toxin concentrations were increased to 5 μM for oligomycin and 2 μM for rotenone/antimycin (Agilent). The ATP production was normalised to the FO slice protein content as measured by Nanodrop (Implen).
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... Membrane fluidity was determined by using an excitation wavelength of 350 nm and measuring fluorescence at 460 nm and 500 nm emission wavelengths on a BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent). The generalised polarisation (GP ...
-
bioRxiv - Microbiology 2023Quote: ... 200 μl were aliquoted into black 96 well plates in triplicate and fluorescence was measured using a BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent). The excitation wavelength used was 488 nm and emission wavelength used was 530 nm.
-
bioRxiv - Molecular Biology 2023Quote: TEV eluates (about 650-700 µl) were partially digested for 5 min at 37 °C with 25 µl of RNase-IT (Agilent) diluted to 1:50 in TNM100 buffer and the reactions were stopped using 0.4 g guanidine hydrochloride ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2000 cells were seeded on a well of a 96-well plate and brightfield images were taken every two hours by using the BioTek BioSpa 8 Automated Incubator and Citation 5 reader (Agilent). BioTek Gen5 imaging software (Agilent ...
-
bioRxiv - Bioengineering 2023Quote: ... slides were counterstained with DAPI (1µg/ml) in PBS for 5 min followed by water washes and cover slipping with fluorescent antifade mounting reagent (DAKO, Agilent).
-
bioRxiv - Bioengineering 2023Quote: ... Peptides were loaded to a nanoscale HPLC column composed of 10 cm of Polaris C18 5 μm packing material (Agilent), followed by 4 cm of Partisphere 5 SCX (Whatman) ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Neuroscience 2023Quote: ... the sections were washed in PBS and incubated in DAPI (1:500) for 5 min before mounting with the immunofluorescence mounting media (DAKO).
-
Downregulation of Let-7 miRNA promotes Tc17 differentiation and emphysema via de-repression of RORγtbioRxiv - Immunology 2023Quote: ... This construct was also used to generate the let-7 ʻseed’ deletion mutant derivative using the QuikChange Multi Site Mutagenesis Kit (catalog 200514-5, Stratagene). 3T3 mouse embryonic fibroblasts (MEFs ...
-
bioRxiv - Plant Biology 2023Quote: ... The sample (5 µl injection volume) was separated on a ZORBAX Eclipse Plus C18 (2.1×50 mm, 1.8 µm, Agilent Technologies, Inc.). Data analysis was performed with Agilent Profinder (v10.0 SP1 ...
-
bioRxiv - Bioengineering 2024Quote: ... Two-channel 85 µm z-stack images were taken using a Cytation 5 V3.14 cell imaging multi-mode reader (Agilent Technologies). A total of 21 z-stacks per well and per experiment were recorded and used for post-processing to calculate the cell phenotypic response in each hydrogel model.
-
bioRxiv - Immunology 2023Quote: ... We performed the HPLC with a normal phase Zobax Sil (5 μm, 4.6 × 150 mm) column (Agilent, Santa Clara, CA). Isocratic chromatographic separation was achieved with 10% ethyl acetate/hexane at a flow rate of 1.4 ml/min ...
-
bioRxiv - Physiology 2023Quote: HPLC separation was performed on an Agilent 1100 HPLC system using a 5 µm C18 column (4.6 mm × 150 mm, Agilent-XDB), maintained at 30°C ...
-
bioRxiv - Immunology 2024Quote: ... Greyhound Chemicals), 10% LC-MS grade water (Ultra CHROMASOLV, Honeywell Riedel-de Haën) with 5 uM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Microbiology 2023Quote: ... The optical density was measured at 540 nm and subtracted from readings at 450 nm using the BioTek Cytation 5 Cell Imaging Multimode Reader (Agilent). Concentrations were calculated from standard curves run in parallel.
-
bioRxiv - Cell Biology 2024Quote: The fluorescence from mNG21-10/mNG211 complementation was visualized the day after transfection with the pH2B-mNG211 plasmid using a Cytation 5 microscope (Agilent) equipped with a 20x/0.45 NA phase contrast objective ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The volatile components were separated by a DB-5 capillary column (30 m × 0.25 mm × 0.25 μm, Agilent, CA, USA) using high-purity helium as carrier gas with a 1.5 mL/min flow rate ...
-
bioRxiv - Microbiology 2024Quote: ... and 280 nm with a Eclipse Plus Phenyl-Hexyl column (250 mm length, 4.6 mm diameter, 5 μm particle size, Agilent Technologies). The flow rate was set to 0.5 mL/min for a 70/30 combination of the mobile phase in water and acetonitrile (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2021Quote: ... 10-20 µl injection volume depending on protein concentration) were injected on a Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) at a flow rate of 100 µl/min using solvent A (0.1% formic acid and 0.05% trifluoroacetic acid in water ...
-
bioRxiv - Molecular Biology 2021Quote: Cross-linked peptides were enriched with Fe(III)-NTA 5 µL in an automated fashion using the AssayMAP Bravo Platform (Agilent Technologies). Fe(III)-NTA cartridges were primed with 250 µL of 0.1% TFA in ACN and equilibrated with 250 µL of loading buffer (80% ACN/0.1% TFA) ...
-
bioRxiv - Genomics 2020Quote: ... gDNA before SRE treatment was diluted 5-fold and the undiluted solution after SRE treatment was used according to the protocol using TapeStation 2200 (Agilent Technologie) and Genomic DNA ScreenTape (Agilent Technologie).
-
bioRxiv - Genetics 2019Quote: ... All qRT-PCR experiments were performed on diluted cDNA (1:5 in nuclease-free water) using the Brilliant II SYBR Green qPCR Master Mix (Agilent Technologies) and the 7900HT Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2019Quote: ... After one last wash with DPBS for 5 minutes at RT the coverslips were imbedded in fluorescent mounting medium (DAKO #S3023). Primary antibodies that were used ...
-
Quantitative proteomics reveals remodeling of protein repertoire across life phases of Daphnia pulexbioRxiv - Systems Biology 2019Quote: ... Pooled samples were desalted via C18 SPE on Sep-Pak cartridges as described above and subjected to basic pH reversed-phase liquid chromatography (bRPLC)[25] over a 4.6 mm x 250 mm ZORBAX Extend C18 column (5 μm, 80 Å, Agilent Technologies) with concatenated fraction combining as previously described ...
-
bioRxiv - Plant Biology 2020Quote: ... All samples were diluted to 3.5 % HNO3 prior to multi-elemental analysis using Inductively-Coupled Plasma Optical Emission Spectrometry (ICP-OES) (5100 ICP-OES, Agilent Technologies). The ICP-OES was equipped with a SeaSpray nebuliser and a double pass scott type spray chamber ...
-
bioRxiv - Genomics 2019Quote: ... Each pool of RNA was individually labelled with Cyanine-3 and Cyanine-5 (Cy3 and Cy5) using the Low input Quick Amp Labelling Kit (Agilent Technologies) followed by purification through Qiagen RNeasy Columns (Qiagen ...
-
bioRxiv - Systems Biology 2020Quote: ... 3 μl of each sample containing approximately 10 μg of total native peptides and 500 fmol of each stable isotope-labeled standard (SIS) peptide were loaded on an analytical column, Zorbax 300SB-C18 (5 μm, 150 × 0.3 mm) (Agilent Technologies, USA) and washed with 5% acetonitrile for 5 min at a flow rate of 20 μl/min ...
-
bioRxiv - Cancer Biology 2021Quote: ... The DNA was denatured at 95°C for 5 min in a PCR machine (PTC-200, MJ Research; PCR strip tubes (Agilent 410022)) and then incubated with the biotin capture RNA at 65°C ...
-
bioRxiv - Biochemistry 2020Quote: The peptide was purified by high-performance liquid chromatography (HPLC) on a C4 column (Phenomenex Jupiter C4, 5 μm, 300 Å, 250 × 10 mm, Agilent) using an acetonitrile/water gradient containing 0.1% TFA ...
-
bioRxiv - Systems Biology 2021Quote: ... using an Aminex HPX-87H ion-exchange column operated at 60°C with 5 mM H2SO4 as the mobile phase with a flow rate of 0.6 mL min-1 (Agilent, Santa Clara). The OD660 was measured with a Jenway 7200 spectrophotometer (Jenway ...
-
bioRxiv - Microbiology 2021Quote: ... Online mass calibration was performed using a second spray needle and a constant flow (5 ul/min) of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). Compounds were identified based on the retention time of chemical standards and their accurate mass (tolerance 20 ppm) ...
-
bioRxiv - Microbiology 2021Quote: ... Online mass calibration was performed using a second spray needle and a constant flow (5 ul/min) of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). Compounds were identified based on the retention time of chemical standards and their accurate mass (tolerance 20 ppm) ...
-
bioRxiv - Plant Biology 2021Quote: ... and 0.25 μm film of 95% dimethyl/5% diphenylpolysiloxane) with a precolumn (10 m J&W integrated with Agilent 122-5532G) was used for compound separation ...