Labshake search
Citations for Agilent :
251 - 300 of 1014 citations for 6 chloro 5 iodonicotinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Generated tryptic peptides were loaded onto a trap column (300SB-C18, 5 × 0.3 mm, 5-μm particle size; Agilent Technologies, Santa Clara, CA, USA) connected through a zero-dead-volume union to the self-packed analytical column (C18 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Plant Biology 2019Quote: ... using a J&W DB-5 MS column (Agilent Technologies) with the oven program ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Plant Biology 2020Quote: ... from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6). For expression analysis in control conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... paraffin embedded TMA slides were processed for antigen retrieval for 15 minutes performed using TAR buffer pH 6 (Dako) in a steamer ...
-
bioRxiv - Molecular Biology 2022Quote: ... Embedded tissue sections were pre-treated with a heat induced epitope retrieval (HIER) method (pH 6, DAKO, Hamburg, Germany). As secondary antibody anti-rabbit Polymer-AP (Enzo Life Sciences ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were incubated for 5 minutes with DAPI (4’, 6-diamidino-2-phenylindole, 0.5ug/mL in 1X PBS) and were mounted using fluorescence mounting medium (Dako). Negative controls were included in each batch by omitting the primary antibody.
-
bioRxiv - Bioengineering 2022Quote: ... Freshly prepared sample (6 μL) was injected on an ZORBAX SB-Aq column (Agilent, 4.6 × 100 mm, 3.5 μm). The column temperature was set to 45 °C ...
-
bioRxiv - Immunology 2021Quote: ... 10μM ADP or 1μM TRAP-6 in the presence of fluorescein isothiocyanate–conjugated polyclonal rabbit anti-fibrinogen antibody (Agilent Technologies LDA UK Limited ...
-
bioRxiv - Cell Biology 2020Quote: ... Amplified cDNA sequences were modified and cloned into BamHI and XhoI sites of pCMV-3FLAG-6 vector (Agilent, 240200). To produce shRNA lentivirus particles ...
-
bioRxiv - Neuroscience 2023Quote: ... plated 3µg/50µl/well onto a 96 well plate with all animals having 6-8 technical replicates (101085-004, Agilent). Mitochondrial-plates were then centrifuged at 2000g ...
-
bioRxiv - Neuroscience 2023Quote: AAV plasmids carrying cDNA for hIL-6 downstream of a CMV promoter were co-transfected with pAAV-RC (Stratagene) encoding the AAV genes rep and cap ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Microbiology 2020Quote: ... The 75th amino acid in the PB1-F2 protein was changed to a histidine (H) via site directed mutagenesis (QuikChange Lightning, Agilent) to produce the PB1-F2-75H plasmid ...
-
bioRxiv - Plant Biology 2020Quote: ... and fluorenylmethoxycarbonyl (FMOC) was based on the application note “Automated amino acids analysis using an Agilent Poroshell HPH-C18 Column” by Agilent. The samples were injected onto a 100 mm x 3 mm InfinityLab Poroshell HPH-C18 column (2.7 μm ...
-
bioRxiv - Cell Biology 2020Quote: Samples from all biological replicates were first sent to the Stanford University Protein and Nucleic Acid Facility (Stanford, CA) for quantification and quality analysis using a 2100 Bioanalyzer (Agilent). Samples were then sent to Novogene Corporation Inc ...
-
bioRxiv - Microbiology 2021Quote: ... Fatty acid methyl esters were identified by their mass spectrum and retention time and quantified by Mass Hunter Quantification Software (Agilent) and the calibration curve generated with fatty acid methyl esters standards mix (Sigma CRM47885) ...
-
bioRxiv - Biochemistry 2020Quote: ... The D614G amino acid change was introduced into VRC7480 by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit from Agilent Technologies (Catalog # 210518) ...
-
bioRxiv - Cell Biology 2019Quote: ... the coding sequence for 81 amino acids downstream of the internal restriction site BsrGI in a construct expressing Gas1* was removed using the QuikChange protocol (Agilent), yielding VGc389 ...
-
bioRxiv - Immunology 2020Quote: ... The codon encoding residue 241 of Copa was mutated from glutamic acid to lysine via Quikchange Lightning site directed mutagenesis (Agilent). Following NotI and PacI digestion ...
-
bioRxiv - Immunology 2019Quote: Purified recombinant His-tagged C-terminal MSP1 protein (amino acids 4960 to 5301) (Ndungu et al., 2009) was biotinylated and tetramerized with streptavidin-PE (Prozyme), as previously described (Krishnamurty et al. ...
-
bioRxiv - Genetics 2019Quote: ... into the complete open reading frame of the canonical 307 amino acid human NMNAT2 isoform cloned into expression vector pCMV-Tag2 (Stratagene). The expressed NMNAT2 proteins have a Flag tag and short linker sequence (17 amino acids ...
-
bioRxiv - Microbiology 2020Quote: ... Hydrolyzed amino acids were separated using ultra performance liquid chromatography (UPLC, Acquity, Waters) on a C-8 column (Zorbax Eclipse XBD, Agilent) at a flow rate of 0.6 mL/min ...
-
bioRxiv - Biochemistry 2020Quote: E.coli expression plasmids encoding GST-PEX14-NTD with amino acid substitutions were constructed via Site Directed Mutagenesis using QuikChange II (Stratagene). ß-tubulin (amino acids 388–444 ...
-
bioRxiv - Bioengineering 2020Quote: ... rehydrated slides were subject to antigen retrieval using citric acid buffer at 120°C and 20 psi in a pressure cooker (DAKO). Afterwards ...
-
bioRxiv - Biophysics 2020Quote: ... Chromatographic separation of OPA-derivatized amino acids was performed using an Agilent ZORBAX Eclipse AAA column (4.6mm x 150 mm x 3.5 μm; Agilent #963400-902) coupled with a ZORBAX Eclipse AAA Analytical Guard Column (4.6 mm x 12.5 mm x 5 μm ...
-
bioRxiv - Microbiology 2021Quote: Levels of volatile fatty acids present in the supernatant of both co-cultures and monocultures were measured using an Agilent1260 Infinity HPLC (Agilent). Samples were prepared by acidifying to 5 mM using sulfuric acid and subsequently incubating at room temperature for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... The 13C-labeling patterns of proteinogenic amino acids were determined on a 6890N Network GC system with a 5975 inert XL mass selective detector (Agilent Technologies Inc. ...
-
bioRxiv - Immunology 2022Quote: ... The D614G amino acid change was introduced into VRC7480 by site-directed mutagenesis using the QuikChange Lightning Site-Directed Mutagenesis Kit from Agilent Technologies (catalog no ...
-
bioRxiv - Immunology 2021Quote: ... we changed three amino acids within the Fc region by using the QuikChange II site directed mutagenesis kits (Agilent, #200523), introducing M257Y ...
-
bioRxiv - Neuroscience 2021Quote: ... TDP-43N-Del was generated by deletion of the first 81 amino acids from the N-terminus of TDP-43WT using the QuickChange Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Molecular Biology 2020Quote: The conservative lysine at position 23 was replaced with glutamic acid to create Meier-Gorlin mutation (K23E) following site-directed mutagenesis protocol (Agilent). Drosophila-Human and Human-Drosophila hybrids were designed by using a PCR technique ...
-
bioRxiv - Plant Biology 2021Quote: Salicylic acid (SA) was extracted from frozen leaf material and analyzed by ultra-high-performance liquid chromatography system (Agilent Technologies) coupled to an Agilent 6530 quadrupole time of flight-mass spectrometer (Agilent Technologies ...
-
bioRxiv - Plant Biology 2019Quote: ... The digest was acidified by adding formic acid to a final concentration of ~ 1 % and desalted using OMIX C18 pipette tips (10 – 100 μL, Agilent). C18 desalting tips were first activated by twice aspiring and discarding 200 μl buffer B2 (0.1 % formic acid ...
-
bioRxiv - Cell Biology 2020Quote: The mCherry-TRAK1 deletion mutant mCherry-TRAK1Δ was obtained by inserting a stop codon after amino acid 635 of the mCherry-TRAK1 encoding nucleotide sequence by means of a PCR-based mutagenesis (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... The extracted phospholipids were methanolized as fatty-acid methyl esters and then analysed using gas chromatography (Agilent Technologies 6890N, UK) [26] ...
-
bioRxiv - Microbiology 2020Quote: ... The GFP-tagged N127143Q mutant was constructed by substitution of asparagines for glutamines at amino acids 127 and 143 by site-directed mutagenesis (Stratagene). The GFP-Rem-T7 partial deletion mutants (GFP-RemΔ103-155-T7 ...
-
bioRxiv - Cell Biology 2022Quote: ... Peptides were acidified by 1% trifluoroacetic acid (TFA) and C18 cleanup was performed using Bravo AssayMAP robot with C18 cartridges (Agilent) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2022Quote: ... The libraries were submitted to the VCU’s Nucleic Acid Sequencing core facility where the quality of the libraries was verified using the bioanalyzer (Agilent Technologies).