Labshake search
Citations for Agilent :
451 - 500 of 1605 citations for 6 METHYL 3 1H TETRAZOL 5 YL 4H CHROMEN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: Whole Human Genome Microarray Kit 4×44K (Agilent, Cat. No. G4112F) was used to detect mRNA expression levels in cells transfected with control and miR-101-3p transfected HCT116 cells ...
-
bioRxiv - Cell Biology 2021Quote: ... overnight at 4°C after blocking with blocking solution (S3022, Dako) for 30 min ...
-
bioRxiv - Cell Biology 2019Quote: ... Each SBC mouse (4*180K) LncRNA microarray slide (Agilent Technologies Inc.) was hybridized with 1.65 μg Cy3-labeled cRNA using a gene expression hybridization kit (Agilent Technologies ...
-
bioRxiv - Immunology 2019Quote: ... and then overnight at 4°C in rabbit anti-CD3 (Dako) in 1% (v/v ...
-
bioRxiv - Genetics 2020Quote: ... at 4°C followed by secondary antibody (Dako Cytomation, Glostrup, Denmark) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2019Quote: ... using the Canis (V2) Gene Expression Microarray 4×44K (Agilent Technologies). Microarray data were subjected to gene ontology (GO ...
-
bioRxiv - Immunology 2022Quote: ... overnight at 4°C in Dako REAL antibody diluent (Dako, S2022). To visualized the specific signal ...
-
bioRxiv - Genomics 2023Quote: ... elegans (V2) Gene Expression Microarray 4 × 44k chips were used (Agilent). Scanning was done with an Agilent High Resolution C Scanner ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4°C hold) by Herculase II fusion enzyme (Agilent Technologies, #600679). After each step ...
-
bioRxiv - Biochemistry 2023Quote: ... Absorbance was measured using a BioTek Synergy 4 plate reader (Agilent).
-
bioRxiv - Bioengineering 2019Quote: ... The electrical state was tested with a resistance meter (34401A 6 ½ Digit Multimeter, Agilent, Santa Clara, CA, USA) between different tapping points (connector – solder pads on interconnecting ceramic – wires anterior to interconnecting ceramic) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... (Mildford, MA, USA) and vacuum manifold system (VacElut 6 Manifold Processing Station, Agilent Technologies, Santa Clara, CA, USA) were used for solid-phase extraction (SPE).
-
bioRxiv - Microbiology 2020Quote: ... The plasmid for production of (His)6-SUMO-σAntA-DD was generated by site-directed mutagenesis (Agilent QuikChange) using primers listed in Table S3 ...
-
bioRxiv - Biochemistry 2022Quote: ... MNase-digested samples were loaded on 6% PAGE and stained with SybrGOLD and run on a Bioanalyzer (Agilent) using DNA High sensitivity chips ...
-
bioRxiv - Molecular Biology 2023Quote: ... serotype 6 (AAV6) vector plasmids were cloned into the pAAV-MCS plasmid (Agilent Technologies, Santa Clara, CA, USA), comprised of inverted terminal repeats (ITRs ...
-
bioRxiv - Cancer Biology 2023Quote: ... The slides were steamed for 35 minutes with a pH 6 Dako Target Retrieval (Agilent Technologies, S169984-2) and permeabilized with 0.1% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... was heated to 40°C for an isocratic 6-minute run paired with a 5977B GC/MSD (Agilent).
-
bioRxiv - Cell Biology 2023Quote: ... siRNA-resistant versions have been obtained by mutating 6 bp of the siRNA-targeting sequence using Quickchange (Agilent).
-
bioRxiv - Genetics 2024Quote: ... serotype 6 (AAV6) vector plasmids were cloned into the pAAV-MCS plasmid (Agilent Technologies, Santa Clara, CA, USA), comprised of inverted terminal repeats (ITRs ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... Generated tryptic peptides were loaded onto a trap column (300SB-C18, 5 × 0.3 mm, 5-μm particle size; Agilent Technologies, Santa Clara, CA, USA) connected through a zero-dead-volume union to the self-packed analytical column (C18 ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 mins at RT prior to examining fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 535 nm and measuring emission at 610 nm ...
-
bioRxiv - Plant Biology 2019Quote: ... using a J&W DB-5 MS column (Agilent Technologies) with the oven program ...
-
bioRxiv - Genomics 2021Quote: ... using 5 μL Fe(III)-NTA cartridges (Agilent, G5496-60085) according to the instructions of the manufacturer ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... Reverse primer: 5’GTTGCAGCATGTTTCAGATGAT3’ with paq polymerase 5000 (Agilent, USA) and resulting PCR products were electrophoresed on 3% agarose gel ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Cancer Biology 2022Quote: ... C18 cartridges (Agilent, 5 μL bead volume, 150 μg capacity) were primed using 100 μL of 90% acetonitrile and equilibrated with 70 μL of 0.1% TFA at 10 μL/min ...
-
bioRxiv - Bioengineering 2022Quote: Images were captured in Cytation 5 (Agilent, Santa Clara, CA) and processed with ImageJ (NIH ...
-
bioRxiv - Microbiology 2022Quote: ... Fluorescence was measured using a Cytation 5 plate reader (Agilent).
-
bioRxiv - Developmental Biology 2023Quote: ... A 30 m HP-5 MS UI (Agilent J&W) column (0.25 mm ...
-
bioRxiv - Biophysics 2023Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). For the I-/Cl- antiport assay ...
-
bioRxiv - Pathology 2024Quote: ... 25 NaHCO3 with 5% CO2 in Synergy Neo2 (Agilent/BioTek). The fluorescence of SNARF-5F were measured in a time dependent manner using Synergy Neo2 (Agilent/BioTek ...
-
bioRxiv - Neuroscience 2020Quote: ... One microliter of sample was used to determine the concentration (Qubit 3.0 fluorometer) and integrity (Agilent 2100 Bioanalyzer, Agilent High Sensitivity DNA Kit). RNA sequencing was performed using the PE100 strategy (HiSeq 2500 ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA labeling and hybridization were performed by using the Agilent One-Color Microarray-Based Gene Expression Analysis protocol (Agilent Technology, V 6.5, 2010). Briefly ...
-
bioRxiv - Biochemistry 2022Quote: ... with HistoVT One (L6F9587, Nacalai Tesque) and stained with the following primary antibodies: anti-insulin antibody (A0564, 1:400; Dako, Santa Clara, CA), anti-glucagon antibody (ab92517 ...
-
bioRxiv - Neuroscience 2021Quote: ... for a minimum of one month (De Guzman et al., 2016) before MRI using a 7.0 Tesla MRI scanner (Agilent Inc., Palo Alto, CA). Scanning was performed as in Misquitta et al ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... One microgram of purified cRNA was fragmented to uniform size and applied to Drosophila (V2) Gene Expression microarray (Agilent Technologies, Design ID 021791) in hybridization buffer ...
-
Physiological variation reflects bioclimatic differences in the Drosophila americana species complexbioRxiv - Evolutionary Biology 2019Quote: ... Each group of 20 flies was then lightly anesthetized and weighed as a group before being irradiated with UV-B light at one of the four experimental intensities using an ultraviolet Stratalinker 2000 (Stratagene, La Jolla, CA). For the 0J exposure - which essentially measures longevity in the absence of acute UV exposure - flies were simply anesthetized ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then transferred into a buffer storage solution of 0.1M PBS with 2mM ProHance and 0.02% sodium azide for a minimum of one month (De Guzman et al., 2016) using a 7.0 Tesla MRI scanner (Agilent Inc., Palo Alto, CA) as in Anacker et al ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA was assayed for purity and integrity using a NanoDrop One™ Spectrophotometer and Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, California), respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... and incubated with the conjugated antibody for one hour before being subjected to flow cytometry analysis on an ACEA NovoCyte Quanteon analyzer (Agilent, Santa Clara, CA). For xenograft TME cellular profiling and in vivo cancer cell HLA expression analysis ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoreactions were visualized using 3-amino-9-ethylcarbazole containing hydrogen peroxide (DAKO, Tokyo, Japan).
-
bioRxiv - Cell Biology 2022Quote: ... 3 μl of cell suspension were mixed with 10ul of fluorescence mounting medium (Dako) and mounted for downstream confocal imaging ...
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Carpinteria, CA, USA). The sections were counterstained with Mayer’s haematoxylin and coverslipped ...
-
bioRxiv - Biochemistry 2021Quote: pGEX4T-3 expression plasmids were transformed into BL21-Codon Plus RIPL competent cells (Agilent). Protein expression was induced at 20°C for 3.5 hr ...
-
bioRxiv - Genetics 2021Quote: ... Products were visualized on a 3% TAE agarose gel and quantified by TapeStation (Agilent).
-
bioRxiv - Biochemistry 2021Quote: ... The purified S protein was separated by an SEC column (BioSEC-3, Agilent, USA) connected to an HPLC system (Analytical HPLC 1260 LC system ...
-
bioRxiv - Neuroscience 2023Quote: ... Fluorescence of plasma samples was directly measured using a Take 3 Microvolume Plate (Agilent), measured using an Agilent Cytation 7 (Excitation ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were washed 3 times with 100 µL of XF Base Media (Seahorse Bioscience) containing 2 mM L-Glutamine ...
-
bioRxiv - Microbiology 2023Quote: ... HT29 SGG UCN34 (n=3) were checked on RNA 6000 Nano chips (Bioanalyzer, Agilent) for quality and integrity ...