Labshake search
Citations for Agilent :
301 - 350 of 3303 citations for 6 IODO BENZO D 1 3 OXAZIN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: cDNA was synthesized by using the AffinityScript One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, US) using extracted RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... or Nanodrop One and RNA integrity was quantified with the Agilent 4200 Tapestation (Agilent Technologies, Santa Clara, CA). Libraries were prepared by the Cornell Transcriptional Regulation and Expression (TREx ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 4 was protein blocking (Background Sniper, Dako Protein Block or Normal block ...
-
bioRxiv - Genomics 2020Quote: ... A D1000 Screen Tape assay (Agilent, Cat.5067-5582/3) was used with the 2200 Tape Station (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD15 (mouse monoclonal, clone Carb-3, Agilent Dako) antibodies were used ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cytokeratin (AE1/3) and vimentin (V9) were purchased from Dako Agilent Technologies ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and endogenous peroxidase was blocked with 3% hydrogen peroxide (DAKO) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 150 x 2.0 mm Polaris 3 C8-A column (Agilent, Middelburg ...
-
bioRxiv - Microbiology 2023Quote: ... or 3) a HiPlex H column (4.6 x 250mm, Agilent). For 1) ...
-
bioRxiv - Neuroscience 2023Quote: ... Afterwards the sections were incubated in a humidified chamber (overnight 4°C) in a peroxidase conjugated immunoglobulin against UEA (DAKO, P289; 1:50). Finally ...
-
Retinal affectation in Huntington’s disease mouse models concurs with a local innate immune responsebioRxiv - Neuroscience 2023Quote: ... and incubated overnight in a humid chamber at 4°C with rabbit anti-glial fibrillary acidic protein (GFAP) antibody (1:500, Z0334, DAKO, Agilent, Glostrup, Denmark), rabbit anti-ionized calcium binding adaptor molecule 1 (Iba-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated for 1h at RT before overnight incubation at 4°C with primary antibodies: Glial Fibrillary Acidic Protein (GFAP) (1/500 Dako Cat. Number Z0334); AQP4 (1/500 ...
-
bioRxiv - Cancer Biology 2019Quote: ... For 8 other samples (1 normal and 3 tumor regions each from 2 patients) only DNA was isolated and targeted panel sequencing (Agilent SureSelect run on a HiSeq) was performed for 257 genes ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Microbiology 2021Quote: ... Total RNA from each extraction was quantified using a NanoDropTM One spectrophotometer and integrity analysed using a Bioanalyzer (Agilent) with the RNA 6000 Nano kit ...
-
bioRxiv - Microbiology 2020Quote: cDNA was synthesized by using Affinity Script One-Step RT-PCR Kit (Cat# 600559, Agilent, Santa Clara, CA, USA). RNA was mixed with random nonamer primers ...
-
bioRxiv - Genetics 2022Quote: ... in one individual by the Hospital for Sick Children (Toronto, Canada) using the Agilent SureSelect Focused Exome Kit (Agilent); in one individual at Hôpital de la Pitié Salpêtrière (Paris ...
-
bioRxiv - Molecular Biology 2023Quote: ... One µL of the library was analyzed on an Agilent 2100 Bioanalyzer using a High Sensitivity DNA chip (Agilent) to assess product profiles and concentrations ...
-
bioRxiv - Biochemistry 2021Quote: ... tissue sections were deparaffinized and permeabilized by citrate buffer (pH 6) for 25 min (Dako). Slices were blocked with 5% donkey serum (37°C ...
-
bioRxiv - Immunology 2020Quote: ... cDNA for Sp110 CARD (aa 6-110) were amplified from MegaMan Human Transcriptome Library (Stratagene). cDNA for the tandem SUMO interaction motifs of RNF4 (aa 38-129 ...
-
bioRxiv - Genetics 2019Quote: ... slides were incubated in antigen retrieval solution (Target Retrieval Solution Citrate pH 6; Dako cytomation) at 98°C for 20 minutes and then cooled at room temperature for 20 minutes ...
-
bioRxiv - Neuroscience 2019Quote: ... or hIL-6 downstream of a CMV promoter were co-transfected with pAAV-RC (Stratagene) encoding the AAV genes rep and cap ...
-
bioRxiv - Microbiology 2023Quote: ... using an ion-exchange column (Agilent Hi-Plex H, 300 × 7.7 mm, 6 μm I.D.) with isocratic elution using 5 mM H2SO4 at 50 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Slides were then microwaved in the presence of DakoCytomation target retrieval solution pH 6 (Dako). Slides were incubated with 0.3% hydrogen peroxide solution in methanol for 15 minutes at room temperature to inhibit internal peroxide activity ...
-
bioRxiv - Cell Biology 2020Quote: ... Germany) followed by overnight incubation at 4 °C with specific primary antibodies: polyclonal rabbit anti-human AAT (1:800) (DAKO A/S, Glostrup, Denmark), mouse monoclonal anti-AAT polymer antibody (clone 2C1 ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated overnight at 4°C in primary antibody (2% NGS in TBST) with either rabbit anti-GFAP (1:2000, Agilent Cat# Z0334, RRID: AB_10013382), rabbit anti-synaptophysin (IgG ...
-
bioRxiv - Cancer Biology 2019Quote: ... for 4 hours at 4°C with rotation and processed using the Agilent Bravo liquid handling system (Agilent Technologies, Santa Clara, CA). Beads were washed twice with 0.1% NP-40 in Tris-buffered saline (50 mM Tris-HCl with 150mM NaCl ...
-
bioRxiv - Biochemistry 2021Quote: ... at 4°C overnight diluted in antibody diluent (Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cell Biology 2020Quote: ... elegans V2 4*44K Microarray chip (Agilent Technologies, USA) at 65°C for 17 hrs ...
-
bioRxiv - Microbiology 2023Quote: ... which are handled with a stacker (BioStack 4, Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed with a 3-laser flow cytometer (Agilent Novocyte) and data were processed with FlowJo (v10.1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luminescence was measured using a Cytation 3 Image Reader (Agilent). The luminescence of vehicle-treated controls was set to 100% ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luciferase activities were measured with Cytation 3 Image Reader (Agilent). Firefly luciferase activities were normalized to those of the Renilla luciferase.
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was quantified using the Gen5 Take 3 Module (Agilent BioTek) and assessed for quality with 260/230 absorbance ratio ...
-
bioRxiv - Cancer Biology 2024Quote: ... Absorbase (450nm) was red with BioTek Cytation 3 (Agilent, California, US).
-
bioRxiv - Plant Biology 2022Quote: ... The hybridized array was immediately scanned with an Agilent Microarray Scanner D (Agilent Technologies, Inc.) Results were extracted using Agilent Feature Extraction software v11.0 (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: Raw data files (.d) were processed using Profinder B.08.00 SP3 software (Agilent Technologies, CA) with an in-house database containing retention time and accurate mass information on 600 standards from Mass Spectrometry Metabolite Library (IROA Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Raw data files (.d) were processed using Profinder B.08.00 SP3 software (Agilent Technologies, CA) with an in-house database containing retention time and accurate mass information on 600 standards from Mass Spectrometry Metabolite Library (IROA Technologies ...
-
bioRxiv - Biochemistry 2023Quote: Raw data files (.d) were processed using Profinder B.08.00 SP3 software (Agilent Technologies, CA) with an in-house database containing retention time and accurate mass information on 600 standards from Mass Spectrometry Metabolite Library (IROA Technologies ...
-
bioRxiv - Genetics 2019Quote: ... Each of the 210 RHO variants was created via site-directed mutagenesis using a one-primer modification to the QuikChange II protocol from Agilent.((Braman ...
-
bioRxiv - Microbiology 2019Quote: ... Spike-in RNAs were added to 100 ng total RNA using the One-color RNA Spike-In kit (Agilent Technologies) and Cy3-labeled cRNAs were synthesized using the Low Input Quick Amp Labeling kit (one-color ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA labeling was done either with a two-color Quick Amp Labeling Kit (4×44K arrays) or with a one-color Low Input Quick Amp Kit (8×60K arrays) according the supplier’s recommendations (Agilent Technologies).
-
bioRxiv - Plant Biology 2019Quote: ... RNA quality was assessed in one aliquot per extract using a Fragment Analyzer (Model CE12, Agilent Technologies, Santa Clara, USA), and samples with low RIN scores (<7 ...
-
bioRxiv - Immunology 2021Quote: ... Total RNA was amplified and Cy3 labeled by using the one-color Low Input Quick Amp Labeling Kit (Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: One-step site directed mutagenesis was conducted on EhDHS1 and EhDHS2 gene by QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies). Overlapping primers for site-directed mutagenesis were designed to replace phenylalanine at amino acid 302 of the pCOLD-EhDHS2 plasmid with lysine ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Each sample pool was barcoded with a specific 10 bp-sequence attached at one side of the amplicons through PCR (7 cycles) and cleaned using AMPure beads (Agilent) at x0.7 ratio ...