Labshake search
Citations for Agilent :
201 - 250 of 1212 citations for 6 Chloro N methyl 5 nitro 4 pyrimidinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... The samples were resuspended in 5% formic acid/5% acetonitrile and fractionated over a ZORBAX extended C18 column (Agilent, 5μm particles ...
-
bioRxiv - Microbiology 2019Quote: ... 1% acetonitrile/0.5% formic acid was used as eluent for 5 minutes to trap and desalt the peptides on the enrichment column (Zorbax SB C18, 0.3 × 5 mm, Agilent). An acetonitrile/0.1% formic acid gradient from 5% to 40% acetonitrile was then used within 120 minutes to separate the peptides on a Zorbax 300 SB C18 ...
-
bioRxiv - Cancer Biology 2019Quote: ... for 4 hours at 4°C with rotation and processed using the Agilent Bravo liquid handling system (Agilent Technologies, Santa Clara, CA). Beads were washed twice with 0.1% NP-40 in Tris-buffered saline (50 mM Tris-HCl with 150mM NaCl ...
-
bioRxiv - Biochemistry 2021Quote: ... at 4°C overnight diluted in antibody diluent (Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Cell Biology 2020Quote: ... elegans V2 4*44K Microarray chip (Agilent Technologies, USA) at 65°C for 17 hrs ...
-
bioRxiv - Cancer Biology 2022Quote: ... cytokeratin (DAKO, Cat. M3515; 1:100 at 4 °C), ki67 (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... which are handled with a stacker (BioStack 4, Agilent Technologies ...
-
bioRxiv - Systems Biology 2020Quote: ... lyophilized samples were resuspended in Buffer A (5 mM NH4HCO2/ 2% ACN) and 5 mg peptide material (5 mg/ml) was loaded onto a reversed phase column (ZORBAX 300Extend-C18, Agilent). Peptides were separate at a flow rate of 2 ml/min and a constant column temperature of 40 °C using a binary buffer system ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 Pulsed-splitless injection was used to inject 5 μL samples onto an HP-5ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... Size exclusion chromatography-inductively coupled plasma-mass spectrometry was performed using an Agilent Technologies 1100 Series liquid chromatography system with a BioSEC 5 SEC column (5 μm particle size, 300 Å pore size, I.D. 4.6 mm, Agilent Technologies) and 7700x Series ICP-MS as previously described50 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Biochemistry 2022Quote: ... SEC profiles for the KWOCAS (Figures 2,3,5 and Supplementary Figure S7) were obtained by high pressure liquid chromatography on an Agilent Bio SEC-5 column (Agilent) at a flow rate of 0.35 mL/min by injection of 10 μL of purified eluate using a mobile phase of Tris-buffered saline (50 mM Tris pH 8 ...
-
bioRxiv - Biophysics 2021Quote: ... The plasmid encoding the protein fused with a His-tag at the N-terminus was transformed in BL21 DE3 pLysS strains (Agilent). Recombinant αE-catenin was expressed via isopropyl 1-thio-β-d-galactopyranoside (IPTG,Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... analysis of intact N-glycans was performed using 2-aminobenzamide (2-AB) labeling and separation on a Zorbax NH2 column (Agilent), essentially as described elsewhere [11 ...
-
bioRxiv - Evolutionary Biology 2020Quote: A mutant version of hA5 with a single N-terminal Cys residues were generated via sitedirected mutagenesis using the QuikChange lightning system (Agilent). The Cys was introduced in the Ser-Asn tag leftover from TEV protease cleavage as Ser-Asn-Cys ...
-
bioRxiv - Biochemistry 2021Quote: Rat Kir6.1 and N-terminal FLAG-tagged (DYKDDDDK) SUR2B were first cloned into pShuttle vectors and then the AdEasy vector (Stratagene), and packaged into recombinant adenoviruses in HEK293 cells according to manufacturer’s instructions63,64 ...
-
bioRxiv - Biochemistry 2021Quote: Tpm isoforms Tpm1.6 and Tpm3.1 (with and without Met-Ala-Ser at the N-terminus) were expressed in ArcticExpress(DE3) RIL cells (Agilent Technologies), grown in Terrific Broth (TB ...
-
bioRxiv - Biochemistry 2020Quote: ... Salmonella typhimurium MsbA (T561C in a C88A/C315A cysteine-less background) with an N-terminal poly-histidine-tag was expressed in BL21-CodonPlus (DE3)-RIPL (Agilent). Expression was induced with 1 mM IPTG for 4 hours at 30°C and membrane proteins were solubilized with 1% DDM and 0.04% sodium cholate in a buffer containing 100 mM NaCl ...
-
bioRxiv - Microbiology 2020Quote: ... 500 μl of culture headspace was sampled via gas-tight syringe and subject to gas chromatography through a HayeSep N column (Agilent) at 90°C in N2 carrier gas ...
-
bioRxiv - Biophysics 2021Quote: hnRNPA1* (where * denotes that the hexa-peptide 259-264 is deleted) protein and deletion constructs were expressed as N-terminally tagged hSUMO fusion proteins in BL21 (DE3) RIPL cells (Agilent) in LB media ...
-
bioRxiv - Biochemistry 2022Quote: ... or a FLAG tag (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) was added on the N-terminus of MBP WT or R919* TRPA1 using Quikchange Lightning site-directed mutagenesis (Agilent).
-
bioRxiv - Neuroscience 2021Quote: ... TDP-43N-Del was generated by deletion of the first 81 amino acids from the N-terminus of TDP-43WT using the QuickChange Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Microbiology 2019Quote: ... Dried FAMES were redissolved in n-hexane and then quantified by gas chromatography (N6890, Agilent Technologies, Santa Clara, CA, USA) and identified with a MIDI Sherlock microbial identification system version 4.5 (MIDI Inc. ...
-
bioRxiv - Molecular Biology 2020Quote: ... NOCT N-terminal point mutants were generated from pCR4 TOPO NOCT (Open Biosystems) and Quikchange site directed mutagenesis PCR (Agilent) to generate NOCT(1-431 ...
-
bioRxiv - Biochemistry 2019Quote: ... vector encoding the pG gene as reported previously26 was site-specifically mutated by the insertion of an N-terminal serine using the QuikChange Lightning Multi Site-Directed Mutagenesis kit (Agilent), according to the manufacturer’s instructions using following forward and reverse primers (ser codon underlined) ...
-
bioRxiv - Microbiology 2019Quote: ... a BglII restriction site within the linker-sequence separating the N-terminal mCherry-tag from hGBP1 was eliminated in pmCherry-hGBP1 by Quickchange Site Directed Mutagenesis (Agilent) using the oligomer pair pmCherry-hGBP1DBglII-F and -R (Table S9) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6XHis tag was added to the N-terminus of Upf1 in pGEM-3Zf (+) using QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) with oligonucleotides 5-N-His-UPF1 and 5-N-HIS-UPF1-r to yield pGEM3Zf(+)-6XHis-UPF1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... GC-MS analysis was performed using an Agilent 8860 GC system equipped with an Agilent 7683 N auto sampler and a Agilent J & W GC columns (30 m × 0.25 mm × 0.2 μm, Agilent technologies USA). The injector was set at 220 °C and 1 μL injections were made with helium as carrier gas ...
-
bioRxiv - Microbiology 2022Quote: ... The copies of expressed hACE2 or SARS-CoV-2 N gene copies in individual tissues were interpolated based on threshold cycle (Ct) values determined using MxPro qPCR software (Agilent). A value of 1 was assigned if gene copies were below the detection limits.
-
bioRxiv - Plant Biology 2022Quote: Carotenoids and chlorophyll analysis was performed on one leaf per plant (n=10) using high-performance liquid chromatography (HPLC) (Agilent 1260 Infinity ...
-
bioRxiv - Molecular Biology 2023Quote: ... each reaction was diluted with 100μl 2X SSC and slot blotted using Bio-Rad Slot blot apparatus onto Hybond-N+ membranes (Amersham) which were UV crosslinked with autocrosslink settings (120mJ/cm2) of Stratalinker 1800 (Stratagene) apparatus ...
-
bioRxiv - Plant Biology 2023Quote: PHDsuper-FN3VRN5 from Zm for XL-MS analysis was inserted into pEC-LIC-His-3C containing a hexa-histidine tag and 3C protease cleavage site at the N terminus and was expressed in BL21 CodonPlus (DE3)-RIL cells (Agilent) in LB medium ...
-
bioRxiv - Immunology 2023Quote: ... analysis of intact N-glycans was performed using 2-aminobenzamide (2-AB) labeling and separation on a Zorbax NH2 column (Agilent), essentially as described elsewhere (Bigge ...
-
bioRxiv - Plant Biology 2023Quote: ... 5989-8310EN (Agilent G1676AA Agilent Fiehn GC/MS Metabolomics RTL Library User Guide. June 2008. Agilent P/N: G1676-90000, Agilent Fiehn GC/MS Metabolomics RTL Library Product Note ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3.1zeo+/ nFlag-cmScarlet-hRobo1 was generated by inserting the Flag tag sequence at the N-terminus after the signal peptide sequence of Robo1 with QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Biochemistry 2024Quote: Genes encoding rat Kir6.2Q52R and N-terminal FLAG-tagged (DYKDDDDK) hamster SUR1 were cloned into pShuttle vectors and then the AdEasy vector (Stratagene), and packaged into recombinant adenoviruses ...
-
bioRxiv - Plant Biology 2020Quote: ... Mega BE-C18 (5 g, 20 ml; Agilent), was conditioned with 100 ml of 100% methanol and equilibrated with 50 ml of deionized water ...
-
bioRxiv - Neuroscience 2020Quote: ... with the 5×SRE-Luc reporter plasmid (Stratagene) and EF1αLacZ (β-galactosidase [β-Gal]) ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA Integrity Number (RIN) ≥5 (2100 Bioanalyzer, Agilent), and in the AD group ...
-
bioRxiv - Cancer Biology 2023Quote: ... A BioTek Cytation 5 (Agilent, Santa Clara, CA) was used to take representative images ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Cancer Biology 2020Quote: ... Slides were microwaved in pH 6 antigen retrieval solution (1X Target Retrieval Solution, Agilent Cat # S1699) to bring near to ...
-
bioRxiv - Genomics 2020Quote: ... Adapter-ligated DNA was amplified for 6-8 cycles using Herc II Fusion DNA polymerase (Agilent). PCR products were purified with AMPure XP beads and subjected to Illumina paired-end sequencing (2x 75 bp).
-
bioRxiv - Immunology 2023Quote: ... Heat-induced epitope retrieval was performed for 15 min in Target Retrieval solution (pH 6) (Dako) and all other steps were as described above for mouse snout processing ...
-
bioRxiv - Immunology 2024Quote: ... Antigen retrieval was performed using Antigen Retrieval Solution (pH 6 or pH 9) (Dako, Glostrup, Denmark) for at least 15 minutes in an autoclave ...
-
bioRxiv - Biochemistry 2021Quote: ... protein samples were diluted to a final concentration of 5 µM with solvent A and then desalted on a reverse phase-C8 cartridge (Zorbax 300SB-C8, 5 µm, 300 µm ID 5 mm, Agilent Technologies) at a flow rate of 50 μl/min for 3 min with 100 % solvent A and subsequently eluted with 70 % solvent B for MS detection ...
-
bioRxiv - Immunology 2019Quote: ... single fractions were loaded onto a trap column (Zorbax 300SB-C18 5 µm, 5 × 0.3 mm, Agilent Biotechnologies, Palo Alto, CA) with a binary pump at a flow rate of 45 µL/min ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 μl of each sample containing 2 μg of total native peptides and 100 fmol of each standard peptide was loaded on a precolumn Zorbax 300SB-C18 (5 μm, 5 × 0.3 mm) (Agilent Technologies, USA) and washed with 5 % acetonitrile for 5 min at a flow rate of 10 μl/minute before analytical LC separation ...
-
bioRxiv - Microbiology 2020Quote: ... n-dodecane samples were subjected to the Agilent 6890N gas chromatograph equipped with a (5%-phenyl)-methylpolysiloxane HP-5 column (length, 30 m; inside diameter, 0.32 mm; film thickness, 0.25 mm; Agilent Technologies, Ratingen, Germany) and a flame ionization detector (FID) ...