Labshake search
Citations for Agilent :
51 - 100 of 1496 citations for 6 Chloro 7H pyrrolo 2 3 d pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were centrifuged at 20.800 xg for 2 min and 100 µl sample was injected on a SEC-HPLC column (Bio SEC-3 300 Å, Agilent, USA) using an Agilent 1260 Infinity II system (Agilent ...
-
bioRxiv - Neuroscience 2024Quote: ... pH 6 (Dako Target Retrieval Solution, S2369), was induced in a steamer for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... Tissue sections were colored via DAB-staining (3, 3-diaminobenzidine; Dako, K3468).
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-Diaminobenzidine (DAB, Agilent) and then counterstained with haematoxylin (Abcam) ...
-
bioRxiv - Biochemistry 2022Quote: ... 6 - trisulfonic acid (ProZyme, Inc., San Leandro, CA) at the reducing termini by reductive amination ...
-
bioRxiv - Microbiology 2023Quote: ... pH 6 (K8005, DAKO, Agilent Technologies Inc., USA). Tissue sections were blocked for endogenous peroxidase and non-specific binding by incubating with 30% H2O2 (H1009 ...
-
bioRxiv - Microbiology 2023Quote: ... pH 6 (K8005, DAKO, Agilent Technologies Inc., USA). Tissue sections were blocked for endogenous peroxidase and non-specific binding by incubating with 30% H2O2 (H1009 ...
-
bioRxiv - Cancer Biology 2023Quote: ... in 3 cycles for 3 hours using the Seahorse XFe24 analyzer system (Agilent Technologies). Inhibitors and substrates were used at the following concentrations ...
-
bioRxiv - Developmental Biology 2019Quote: ... service pack 3 (Agilent Technologies).
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm column (Agilent), column temperature 50 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... For 8 other samples (1 normal and 3 tumor regions each from 2 patients) only DNA was isolated and targeted panel sequencing (Agilent SureSelect run on a HiSeq) was performed for 257 genes ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Molecular Biology 2022Quote: ... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
bioRxiv - Microbiology 2019Quote: ... GFAP (Dako #M076101-2 or #Z033429-2), OLIG2 (R&D Systems #AF2418 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Cell Biology 2021Quote: ... 3-diaminobenzidine (DAB) solution (Dako, USA) until signal was detected ...
-
bioRxiv - Cancer Biology 2022Quote: ... and KI67 (clone TEC-3, Dako) were then incubated on the tissue slices and bound antibody was detected with biotinylated goat anti-rat IgG (Southern Biotechnology) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-diaminobenzidine tetrahydrochloride (DAB; Dako, K3467), as chromogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ diaminobenzidine (DAB) (Dako, Carpinteria, CA) and counter-staining was done with hematoxylin ...
-
bioRxiv - Biochemistry 2023Quote: ... or a BIOSEC 3 column (Agilent; flow rate ...
-
bioRxiv - Neuroscience 2022Quote: ... HEK-293T cells were co-transfected with the following plasmids: pAAV/L7-6-Slc9A6-GFP or pAAV/L7-6-GFP (control) with pHelper (Stratagene, La Jolla, CA, USA), and pUCmini-iCAP-PHP.eB followed by viral particles purification ...
-
bioRxiv - Developmental Biology 2020Quote: ... Guinea Pig anti-Insulin pre-diluted 1:6 (Dako 1R002), Chicken anti-GFP 1:1000 (Abcam ab13970) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... low pH∼6 (Dako, K8005; Agilent, Santa Clara, CA, USA), with preheating to 80°C and increased temperature to 95°C for 20min after slides were added ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... low pH∼6 (Dako, K8005; Agilent, Santa Clara, CA, USA), with preheating to 80°C and increased temperature to 95°C for 20min after slides were added ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Cancer Biology 2023Quote: The LC-MS/MS data were processed by Agilent Mass Hunter Workstation Data Acquisition (.d) and analyzed by Agilent Mass Hunter Profinder for batch recursive feature extraction ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3′ - Diaminobenzidine (DAB+) solution (DakoCytomation, Glostrup, Denmark), and counterstained by Harris hematoxylin.
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-Krt5/6 (1:200; M7237; Agilent; Santa Clara, CA), and mouse anti-Krt14 (1:200 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antigen was retrieved using DakoCytomation target retrieval solution pH 6 (Dako). Samples were then blocked with serum-free protein block solution (Dako ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sure 2 (Agilent) competent cells were transformed with the ligation product and cultured at reduced temperatures (27°C) ...
-
bioRxiv - Cell Biology 2024Quote: ... 3,3’-diaminobenzidine (DAB) substrate (Agilent Cat#GV82511-2 or GV92511-2), Dako REAL Peroxidase-blocking reagent (Agilent S202386-2) ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-human CD20 (Dako, clone L26, 1:1000, pH 6 retrieval), mouse anti-human FOXP3 (Abcam ...
-
bioRxiv - Bioengineering 2019Quote: ... Stage 6 clusters were loaded into islet capture microplates (Agilent; 101122-100) in RPMI with 2 mM glucose ...
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct ...
-
bioRxiv - Biochemistry 2023Quote: ... Antigen retrieval was performed with Citrate Buffer (pH 6) (Dako, Glostrup, Denmark). Immunohistochemical staining was performed with anti VEGFA or anti-S100A8 (Table I) ...
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...