Labshake search
Citations for Agilent :
201 - 250 of 466 citations for 6 CHLORO N HEXANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... NOCT N-terminal point mutants were generated from pCR4 TOPO NOCT (Open Biosystems) and Quikchange site directed mutagenesis PCR (Agilent) to generate NOCT(1-431 ...
-
bioRxiv - Biochemistry 2019Quote: ... vector encoding the pG gene as reported previously26 was site-specifically mutated by the insertion of an N-terminal serine using the QuikChange Lightning Multi Site-Directed Mutagenesis kit (Agilent), according to the manufacturer’s instructions using following forward and reverse primers (ser codon underlined) ...
-
bioRxiv - Microbiology 2019Quote: ... a BglII restriction site within the linker-sequence separating the N-terminal mCherry-tag from hGBP1 was eliminated in pmCherry-hGBP1 by Quickchange Site Directed Mutagenesis (Agilent) using the oligomer pair pmCherry-hGBP1DBglII-F and -R (Table S9) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6XHis tag was added to the N-terminus of Upf1 in pGEM-3Zf (+) using QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent) with oligonucleotides 5-N-His-UPF1 and 5-N-HIS-UPF1-r to yield pGEM3Zf(+)-6XHis-UPF1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... GC-MS analysis was performed using an Agilent 8860 GC system equipped with an Agilent 7683 N auto sampler and a Agilent J & W GC columns (30 m × 0.25 mm × 0.2 μm, Agilent technologies USA). The injector was set at 220 °C and 1 μL injections were made with helium as carrier gas ...
-
bioRxiv - Microbiology 2022Quote: ... The copies of expressed hACE2 or SARS-CoV-2 N gene copies in individual tissues were interpolated based on threshold cycle (Ct) values determined using MxPro qPCR software (Agilent). A value of 1 was assigned if gene copies were below the detection limits.
-
bioRxiv - Plant Biology 2022Quote: Carotenoids and chlorophyll analysis was performed on one leaf per plant (n=10) using high-performance liquid chromatography (HPLC) (Agilent 1260 Infinity ...
-
bioRxiv - Molecular Biology 2023Quote: ... each reaction was diluted with 100μl 2X SSC and slot blotted using Bio-Rad Slot blot apparatus onto Hybond-N+ membranes (Amersham) which were UV crosslinked with autocrosslink settings (120mJ/cm2) of Stratalinker 1800 (Stratagene) apparatus ...
-
bioRxiv - Plant Biology 2023Quote: PHDsuper-FN3VRN5 from Zm for XL-MS analysis was inserted into pEC-LIC-His-3C containing a hexa-histidine tag and 3C protease cleavage site at the N terminus and was expressed in BL21 CodonPlus (DE3)-RIL cells (Agilent) in LB medium ...
-
bioRxiv - Immunology 2023Quote: ... analysis of intact N-glycans was performed using 2-aminobenzamide (2-AB) labeling and separation on a Zorbax NH2 column (Agilent), essentially as described elsewhere (Bigge ...
-
bioRxiv - Plant Biology 2023Quote: ... 5989-8310EN (Agilent G1676AA Agilent Fiehn GC/MS Metabolomics RTL Library User Guide. June 2008. Agilent P/N: G1676-90000, Agilent Fiehn GC/MS Metabolomics RTL Library Product Note ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA3.1zeo+/ nFlag-cmScarlet-hRobo1 was generated by inserting the Flag tag sequence at the N-terminus after the signal peptide sequence of Robo1 with QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Biochemistry 2024Quote: Genes encoding rat Kir6.2Q52R and N-terminal FLAG-tagged (DYKDDDDK) hamster SUR1 were cloned into pShuttle vectors and then the AdEasy vector (Stratagene), and packaged into recombinant adenoviruses ...
-
bioRxiv - Cancer Biology 2020Quote: ... Slides were microwaved in pH 6 antigen retrieval solution (1X Target Retrieval Solution, Agilent Cat # S1699) to bring near to ...
-
bioRxiv - Genomics 2020Quote: ... Adapter-ligated DNA was amplified for 6-8 cycles using Herc II Fusion DNA polymerase (Agilent). PCR products were purified with AMPure XP beads and subjected to Illumina paired-end sequencing (2x 75 bp).
-
bioRxiv - Physiology 2021Quote: HUVECs (passages 4-6) were seeded in XFe 24 well plates (Agilent, Santa Clara, CA, USA) at 30,000 cells per well in 200 µL EGM for 48 h ...
-
bioRxiv - Immunology 2023Quote: ... Heat-induced epitope retrieval was performed for 15 min in Target Retrieval solution (pH 6) (Dako) and all other steps were as described above for mouse snout processing ...
-
bioRxiv - Immunology 2024Quote: ... Antigen retrieval was performed using Antigen Retrieval Solution (pH 6 or pH 9) (Dako, Glostrup, Denmark) for at least 15 minutes in an autoclave ...
-
bioRxiv - Molecular Biology 2019Quote: ... The mutations in amino acid position 339 of KLF1 were introduced by site directed mutagenesis (Agilent Technologies), primers are available upon request ...
-
bioRxiv - Biochemistry 2019Quote: ... using a linear gradient from 5 to 55% acetonitrile over 6.5 min with 0.1% formic acid as the aqueous mobile phase after an initial hold at 95% 0.1% formic acid for 0.5 min (0.6 mL/min) using a 1290 Infinity II UHPLC (G7120AR, Agilent). Peptides were identified using LC-HRMS as described previously.23
-
bioRxiv - Genomics 2021Quote: ... Quality and size distribution of the captured genomic segments were verified by TapStation nucleic acids system (Agilent) assessments of regular or bisulfite-converted libraries ...
-
bioRxiv - Neuroscience 2021Quote: ... Periodic acid-Schiff staining (PAS) was performed using an Artisanlink Pro machine (AR16511-2 kit, Dako-Agilent).
-
bioRxiv - Neuroscience 2021Quote: ... Periodic acid-Schiff staining (PAS) was performed using an Artisanlink Pro machine (AR16511-2 kit, Dako-Agilent).
-
bioRxiv - Biochemistry 2019Quote: ... 0.1% [v/v] formic acid in water and injected onto an Agilent1200 (Agilent, Santa Clara, CA, USA) nano-flow LC system that was in-line coupled to the nano-electrospray source of a LTQ-Orbitrap Discovery hybrid mass spectrometer (Thermo Scientific ...
-
bioRxiv - Zoology 2021Quote: ... The amino acid composition of the hydrolyzed samples was determined using High Performance liquid Chromatography (HPLC-Agilent 1260 Infinity series ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were acidified with 1% formic acid (FA) and purified using OMIX C18 Mini-Bed tips (Agilent) prior to LC-MS/MS analysis.
-
bioRxiv - Neuroscience 2023Quote: ... and β-amyloid analysis (pretreatment with formic acid, antibody 4G8, DAKO, M087201-2, 1:100, 30 minutes). Tau pathology was assessed using Braak criteria (Braak et al ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a (C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). The photoproducts of DEAC-OXM were generated and analyzed in an analogous manner ...
-
bioRxiv - Neuroscience 2023Quote: ... 0-8 min with 0.1% formic acid) and a C-18 column (4.6 × 50 mm, 1.8 μm) (Agilent). Each compound was assessed in triplicate ...
-
bioRxiv - Microbiology 2023Quote: ... Amino acid analysis was performed by high-pressure liquid chromatography (HPLC) (Agilent 1100; Agilent Technologies, Massy, France) with a guard cartridge and a reverse phase C18 column (Zorbax Eclipse-AAA 3.5 μm ...
-
bioRxiv - Microbiology 2023Quote: ... Cellular fatty acids were extracted and determined from dried cells by using GC (model 7890A, Agilent, USA) according to the protocol of the Sherlock Microbial Identification System (61) ...
-
bioRxiv - Immunology 2024Quote: ... Amino acid substitutions in G12V-TCR were generated by quick-change site-directed PCR mutagenesis (Agilent, USA). TCRs were transiently transfected into 293T-mCD3-GFP cells and stained separately with PE anti-mTCRβ mAb (Biolegend ...
-
bioRxiv - Physiology 2024Quote: ... Total bile acids assay (Diazyme Laboratories, CA, USA) and BioTek Epoch Microplate Spectrophotometer (Agilent Technologies, CA, USA) were used to measure total BA concentrations to determine the volume of cholestyramine-untreated extract needed to add for a final concentration of ∼300 μM BAs in the ileal explant culture media ...
-
bioRxiv - Cell Biology 2022Quote: ... All mutations and the addition of the Myc-tag to the N-terminus of α-PheRS were made by following the procedure of the QuickChange Site-Directed Mutagenesis Kit (Stratagene). The genomic α-PheRS rescue construct (Myc::α-PheRS ...
-
bioRxiv - Biophysics 2020Quote: ... Human SHP-1 with an N-terminal 6x His tag was produced in Escherichia coli BL21-CodonPlus (DE3)-RIPL strain (Agilent Technologies) and purified on Ni2+-NTA agarose (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2022Quote: Telomeric (TTAGGG)n repeats were detected by FISH using a commercial telomere PNA probe directly labelled with Cy3 (DAKO, Glostrup, Denmark) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Glutathione S-transferase (GST) hERG1a N-terminal domains or GST-only negative controls constructs were grown in BL21 (DE3) competent cells (Agilent Technologies) until they reached exponential growth ...
-
bioRxiv - Molecular Biology 2021Quote: The hydrophobic residues Phe5 and Leu7 in LepB TMH1 were replaced with arginine (R) in construct N = 55 by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden). Multiple alanine substitutions (underlined ...
-
bioRxiv - Molecular Biology 2021Quote: ... Single alanine substitutions of Cys171 and Cys177 in construct N = 223 were made by site-directed mutagenesis using PfuUltra II Fusion HS DNA Polymerase (Stratagene, Sweden).
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence was mutagenized to obtain the N-ter tag canonical variant 2 through the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521) using the following DNA primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Molecular Biology 2023Quote: ... desorption was performed at 250°C for 1’ (splitless mode) in the injection port of a 6890 N gas chromatograph (Agilent Technologies) coupled to a 5975B mass spectrometer (Agilent Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... These SCX fractions (n = 5) were cleaned up using C18 spin columns (Peptide Cleanup Spin Tubes, Agilent Technologies, USA, #5188-2750) and dried using SpeedVac at 22 °C.
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Cell Biology 2023Quote: ... and the N-terminal 6xHis-tagged and C-terminal EGFP-tagged proteins were expressed in Arctic Express (DE3) RP cells (Agilent Technologies). Bacterial cultures in LB medium were induced with 0.1-0.2 mM IPTG at exponential growth phase (OD600 = 0.5-0.6 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Barcoded cDNA libraries containing 5-6 LMD samples plus a Universal Human Reference RNA (UHR) standard (Stratagene) were prepared on the Ion Chef System using the Ion Ampliseq Chef DL8 materials and the Ion AmpliSeq Transcriptome Human Gene Expression Panel Chef-ready Kit (Thermo Fisher) ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was isolated from near-confluent 6 cm dishes using the Absolutely RNA Miniprep kit (Agilent) including an on-column DNase treatment step according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cultures were blocked for 45 min with blocking buffer (BB) containing 6%Goat serum (Dako, S-100) in DPBS ...
-
bioRxiv - Neuroscience 2019Quote: ... PSD-95 in tissues from the L4-6 spinal cord segments were amplified by PCR (Stratagene M3005p), and a pair of GAPDH primers and Taqman probe were added into each reaction system as the internal reference of PCR amplification ...
-
bioRxiv - Developmental Biology 2020Quote: ... The following primary antibodies and dilutions were used: guinea pig anti-Insulin (1:6, Dako, IR00261-2), mouse anti-Glucagon (1:500 ...