Labshake search
Citations for Agilent :
401 - 450 of 3995 citations for 6 Bromo N tert butyl 2 4 chlorophenyl imidazo 1 2 a pyridin 3 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... according to manufacturer’s protocol with diaminobenzidine (DAB; K346811-2; Agilent) as the chromogen ...
-
bioRxiv - Systems Biology 2023Quote: ... Slides were mounted with Glycergel mounting medium (Agilent # C056330-2) and stored at 4C before imaging ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Hematoxylin and Eosin (H&E) (Agilent Technologies, #CS11830-2) staining was performed using the DAKO CoverStainer ...
-
bioRxiv - Bioengineering 2022Quote: ... A hematoxylin (Cat #K800821-2, Agilent, Santa Clara, CA, USA) counterstain was then applied ...
-
bioRxiv - Cancer Biology 2023Quote: ... or rabbit anti-mouse IgG HRP (Agilent technologies, P044701-2) at 1:5000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM Seahorse XF glutamine solution (Agilent, cat# 103579-100)) on the day of experiment ...
-
bioRxiv - Cancer Biology 2023Quote: ... at 10mM (Cat No. S236984-2 Agilent, Santa Clara, CA) using Col IV (Sigma Cat# AB769 ...
-
bioRxiv - Cell Biology 2024Quote: ... then blocked with protein-free serum block (Agilent, #X090930-2) for 1 hour and incubated at 4 degrees overnight with the corresponding primary antibodies ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Yeast cells were grown in a BioTek Epoch 2 (Agilent) microplate reader to monitor growth at OD630 in three biological replicates.
-
bioRxiv - Cell Biology 2023Quote: ... with approximately 10 μL of mounting media (Dako, S302380-2).
-
bioRxiv - Molecular Biology 2023Quote: ... a histological staining with Mayer’s hematoxylin (Dako, cat.no.: S330930-2) followed by Eosin (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... EnVision+ Rabbit (K400311-2, Agilent Technologies, Inc., Santa Clara, CA) was used as a secondary antibody ...
-
bioRxiv - Cell Biology 2021Quote: ... Single cells were separated using a 100 μm strainer and labelled with CD31 antibody (1:200, M082329-2, DAKO) at 4°C for 45 min followed by 30 min staining with a goat anti-mouse secondary antibody conjugated to AlexaFluor 488 or 555 (1:400 ...
-
bioRxiv - Immunology 2022Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). Basal OCR and ECAR were measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2% BSA (PAA Laboratories GmbH, Germany) and 1:50 dilution of normal goat serum (Dako Denmark A/S, Denmark). Subsequently ...
-
bioRxiv - Immunology 2020Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). OCR was measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Immunology 2024Quote: ... coated XFe96 plate with fresh XF media (Seahorse XF RPMI medium containing 10 mM glucose, 2 mM L-glutamine, and 1 mM sodium pyruvate, PH 7.4; all reagents from Agilent). OCR was measured in the presence of Oligomycin (1.5 μM ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Synthetic Biology 2020Quote: ... The hybridisation mix was prepared by mixing the specified amounts of RNA with 10× Gene Expression Blocking Agent (1× final conc.) and 2× Hi-RPM Hybridization Buffer (1× final conc.) (Agilent, Cat No. 5188-5242) in a final volume of 42 μl ...
-
bioRxiv - Plant Biology 2020Quote: ... The digest was filtered (0.22 μm) and filtered samples (1-2 μg) were loaded onto a C18 high capacity nano LC chip (Agilent Technologies) using a 1200 series capillary and eluted directly into a 6550 series quadrupole time-of-flight mass spectrometer (Agilent Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... We used additional microglial markers including mouse anti-MHC-II/HLA-DP/DQ/DR (1:250, M077501-2, Agilent, UK), rabbit anti-PU.1 (1:200 ...
-
bioRxiv - Cell Biology 2021Quote: ... sections were incubated for 2 hours at room temperature with polyclonal guinea pig anti-insulin antibody (1:5, Agilent Technologies). Slides were then washed 3 x 5 minutes with PBS and incubated with the Anti-guinea pig IgG Alexa Fluor 488 (1:200 ...
-
bioRxiv - Molecular Biology 2020Quote: ... were introduced using RE specific primers (Table 1 and Table 2 in supplementary material) by QuickChange Multi site-directed mutagenesis kit (Agilent) according to manufacturer’s instructions.
-
Engineering of membrane complex sphingolipids improves osmotic tolerance of Saccharomyces cerevisiaebioRxiv - Bioengineering 2019Quote: ... The dried samples were sent to the Profleader Institute for complex sphingolipids analysis and solubilized in dichloromethane-methanol (2:1,vol/vol) before analysis by UHPLC-QTOF-MS (Agilent) analysis (Fig ...
-
bioRxiv - Neuroscience 2021Quote: ... 25 and 50 ppb with Sc-45 (ICP-MS internal standard mix 1 ug/mL in 2% HNO3, Agilent Technologies) as the internal standard for Cu-63.
-
bioRxiv - Microbiology 2021Quote: Immunofluorescent (IF) staining was performed using the following primary antibodies: polyclonal rabbit anti-HSV-1 (cross-reactive with HSV-2; Agilent), anti-Iba1 (Wako ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were permeabilized with 0.2% Triton X-100 in 2% fish gel for 2 hours at room temperature and immunohistochemically labelled with the primary antibody (1:200 rabbit anti-GFAP, Z0334 Dako; 1:200 rabbit anti-Iba1 ...
-
bioRxiv - Immunology 2023Quote: ... Cellular sphingolipids were analyzed after extraction with methanol:chloroform (2:1) using a 1290 Infinity II HPLC coupled with a 6495C triple-quadrupole mass spectrometer (Agilent Technologies) as previously described (Naser et al. ...
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with a KpnI site inserted at the 5’ end of Δ3-1 or Δ3-2 (Quick Change Site-Directed Mutagenesis from Stratagene) using the oligonucleotides Δ3-1-KpnI Fw ...
-
bioRxiv - Developmental Biology 2023Quote: ... membranes were incubated for 1 h at room temperature with polyclonal goat anti-rabbit secondary antibody IgG/HRP (P044801-2; Agilent Technologies/Dako ...
-
bioRxiv - Neuroscience 2024Quote: ... The cells were washed once with DMEM Assay Medium (XF DMEM [Agilent] supplemented with XF glucose [10 mM, Agilent], XF glutamine [2 mM, Agilent] and XF pyruvate [1 mM, Agilent]), then left in DMEM Assay Medium and placed in a non-CO2 incubator for 1 hour ...
-
bioRxiv - Immunology 2024Quote: ... The membranes were washed and incubated at room temperature for 1 h with rabbit anti-mouse IgG (Agilent, P026002-2) or goat anti-rabbit IgG (Agilent ...
-
bioRxiv - Immunology 2024Quote: ... and MØ cell culture media was replaced with FCS-and bicarbonate-free DMEM medium supplemented with 4.5 mg ml-1 D-glucose and 2 mM glutamine (Agilent, USA) for another 60 min incubation at 37°C without CO2 ...
-
bioRxiv - Genomics 2024Quote: ... We selected for guide integration with 2µg/ml puromycin and then induced prime editor expression with 1 µM doxycycline and determined editing rates by visualizing amplicons (Supplementary Table 2) on the bioanalyzer (Agilent).
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-Krt5/6 (1:200; M7237; Agilent; Santa Clara, CA), and mouse anti-Krt14 (1:200 ...
-
bioRxiv - Microbiology 2019Quote: ... and 6’-Sialyllactosamine (6’SLN) (Prozyme, Hayward CA) were used to annotate HPLC peaks ...
-
bioRxiv - Cancer Biology 2021Quote: ... slides were incubated with HPR-conjugated secondary antibodies (Agilent, K400311-2) for 30 min ...
-
bioRxiv - Physiology 2021Quote: ... and serum-free protein block (X090930-2) were from Dako (Agilent). Rabbit anti-Ki67 mAb D3B5 (9129 ...
-
bioRxiv - Genomics 2020Quote: ... followed by 2 min in bluing buffer (DAKO, Agilent, California, USA) and 10 sec in eosin Y (1:20 in slightly acidic pH 6 Tris) ...
-
bioRxiv - Genomics 2020Quote: ... followed by 2 min in bluing buffer (DAKO, Agilent, California, USA) and 10 sec in eosin Y (1:20 in slightly acidic pH 6 Tris) ...
-
bioRxiv - Genomics 2020Quote: ... Slides then incubated with serum-free protein block (Agilent X090930-2) for 30 mins as an extra blocking step in order to prevent nonspecific antibody binding ...
-
bioRxiv - Immunology 2021Quote: ... and blocked in 0.002% saponin with 2% goat serum (DaKoCytomation, Denmark). The outer membrane of T ...
-
bioRxiv - Cancer Biology 2020Quote: ... or EnVision+ HRP anti-mouse (Dako, Carpinteria, CA; catalog #K400111-2) secondary antibodies and developed using DAKO DAB ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides were treated with EnVision FLEX Hematoxylin (Agilent DAKO, K800821-2) and mounted using the same protocol as used for IHC slides.
-
bioRxiv - Cancer Biology 2020Quote: ... slides were treated with EnVision FLEX Hematoxylin (Agilent DAKO, K800821-2) and mounted using the same protocol as used for IHC slides.
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... 2 µL Herculase II Fusion DNA polymerase (Agilent Technologies, Cat# 600677), 20 µL 5X Herculase buffer ...
-
bioRxiv - Microbiology 2021Quote: ... packed with 2 mm Zorbax 80XDB C18 reverse phase beads (Agilent), was connected to the trap column for peptides separation ...
-
bioRxiv - Cell Biology 2021Quote: ... then followed by anti-Rabbit HRP secondary (Agilent, Cat# P044801-2) at 1:4000 diluted with 5% bovine serum albumin solution ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells (2×104/well) were seeded in XF96 well plates (Agilent), adhered overnight ...