Labshake search
Citations for Agilent :
501 - 550 of 3968 citations for 6 BROMO 4 4 DIETHYL 1H BENZO D 1 3 OXAZINE 2 4H THIONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 15 min) before incubation with either rabbit anti-mouse IgG (1.3 µg ml−1, 1% BSA in PBST; Agilent, P026002-2), goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... low pH∼6 (Dako, K8005; Agilent, Santa Clara, CA, USA), with preheating to 80°C and increased temperature to 95°C for 20min after slides were added ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... low pH∼6 (Dako, K8005; Agilent, Santa Clara, CA, USA), with preheating to 80°C and increased temperature to 95°C for 20min after slides were added ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-myeloperoxidase (MPO) at a dilution of 1:200 (A039829-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-mouse IgG (1.3 μg ml−1, 5% milk in PBST; Dako, P026002-2) or goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Bioengineering 2022Quote: ... Incubation with secondary antibodies diluted in blocking solution was performed 1 h at RT: anti-rabbit-IgG conjugated to horseradish peroxidase (1:10,000, cat. no. P044801-2; Dako, Carpinteria, CA, USA), anti-mouse-IgG conjugated to horseradish peroxidase (1:10,000 ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA concentration was measured by Nanodrop and 1 to 3 μg of RNA was reverse transcribed with AffinityScript Multi-Temp RT (Agilent) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... an optimal mutation rate (0.3–1 base/kb) for 1µg of template was adopted as recommended in GeneMorph II Random Mutagenesis kit (Agilent Technologies). The PCR products were then digested with EcoRI and HindIII and ligated into the pJF118EH vector using the same restriction enzymes ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were subjected to antigen retrieval antigen retrieval (pH = 6.0 for cleaved caspase-3 and pH = 9.0 for cleaved PARP-1) followed by washing with PBS and incubation in hydrogen peroxide (Dako, #S2003) to inhibit endogenous peroxidase ...
-
bioRxiv - Immunology 2022Quote: ... the ELISA plates were washed 3 times with TBS buffer and a rabbit anti-human HRP antibody 1:3000 (Dako) in blocking solution was applied for 1 hour (RT ...
-
bioRxiv - Cancer Biology 2019Quote: ... Devices were then washed with 1× PBS solution for 3 times and mounted on glass slides using fluorescent mounting medium (Dako) and the coverslips were sealed using nail polish ...
-
bioRxiv - Neuroscience 2021Quote: ... free floating sections were blocked with 3% donkey serum and incubated overnight with either rabbit anti-GFAP (1:10000, Dako), rat anti-CD68 (1:200 ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Cell Biology 2023Quote: ... Endogenous peroxidases were blocked by incubation with 3 % H2O2 and then blocked for 1 h (Dako Serum-free protein block). Sections were then incubated with the 1st primary antibody (FABP7 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Immunology 2024Quote: ... residues D141 of Regnase-1 and D252 of Regnase-3 were mutated to asparigines using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) following manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: The LC-MS/MS data were processed by Agilent Mass Hunter Workstation Data Acquisition (.d) and analyzed by Agilent Mass Hunter Profinder for batch recursive feature extraction ...
-
bioRxiv - Biochemistry 2021Quote: ... Antigen retrieval using a standard pH 6 sodium citrate buffer (BioGenex) was performed and sections were stained with Monoclonal Mouse Anti-Human CD45 (Dako, M0701, dilution 1:200) using the M.O.M ...
-
bioRxiv - Neuroscience 2021Quote: ... then stained with: rabbit polyclonal (pAb) glial fibrillary acidic protein (GFAP,1:1000, Dako, Z033401-2), goat pAb glial fibrillary acidic protein (GFAP,1:300 ...
-
bioRxiv - Plant Biology 2020Quote: ... equipped with a 80/100 alumina column (1/8” x 2 mm x 1.5 m, Agilent) and set with the following parameters ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated for 2 hours in biotinylated swine anti-rabbit secondary antibody (1:200, Dako) followed by 2-hour incubation in Vectastain ABC (avidin-biotin ...
-
bioRxiv - Immunology 2020Quote: ... Thermo Fisher MA USA) followed by SA-HRP (1:2000 dilution, #P030701-2, Dako, CA USA), and visualised with TMB (#421101 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3′ - Diaminobenzidine (DAB+) solution (DakoCytomation, Glostrup, Denmark), and counterstained by Harris hematoxylin.
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antigen was retrieved using DakoCytomation target retrieval solution pH 6 (Dako). Samples were then blocked with serum-free protein block solution (Dako ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sure 2 (Agilent) competent cells were transformed with the ligation product and cultured at reduced temperatures (27°C) ...
-
bioRxiv - Bioengineering 2019Quote: ... The microtissues were then washed in PBS (3 × 1 hour) before mounting on glass slides using fluoro-safe mounting media (Dako, S3023). Mounted samples were allowed to cure for 1 day and then imaged using a confocal microscope (Zeiss LSM700 Confocal Microscope).
-
bioRxiv - Neuroscience 2021Quote: ... DNA was labeled with Hoechst (1:2000) for 3 min and the sections were mounted using fluorescence mounting media (Dako, S3023). All images were taken using a Zeiss Observer Z1 fluorescent microscope using a 10X objective ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Molecular Biology 2020Quote: ... membranes were incubated with rabbit anti-mouse horseradish peroxidase (HRP) conjugated antibody (P026002-2, Dako, 1:1000) as secondary antibody at RT for 1 h ...
-
bioRxiv - Bioengineering 2019Quote: ... Hydrogels were incubated in a 1:100 dilution mouse anti-human CD31 primary antibody (Agilent IS61030-2) overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-CD3 antibody at a dilution of 1:200 (A045229-2, Dako Agilent Pathology Solutions), rat monoclonal anti-CD45 antibody at a dilution of 1:100 (05-1416 ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-CD3 antibody at a dilution of 1:200 (A045229-2, Dako Agilent Pathology Solutions), rat monoclonal anti-CD45 antibody at a dilution of 1:100 (05-1416 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2% BSA in 0.1% PBS-Tx and stained with rabbit anti-human tau antibodies (1:1000; Dako) or mouse anti-phospho tau PHF-1 (1:1000 – thermofisher) ...
-
bioRxiv - Immunology 2021Quote: ... FcR binding was quantified by incubating immune complexes with biotinylated FcRs (FcγR2A-1, FcγR2A-2, FcγR3A, courtesy of Duke Protein Production Facility) conjugated to Steptavidin-PE (Prozyme). Flow cytometry was performed with an IQue (Intellicyt ...
-
bioRxiv - Immunology 2020Quote: ... consistently identified GFAP peptides while minimizing nonspecific off-target peptide identification (Agilent Z033429-2, 1:200 dilution). Each peptide was required to have a minimum of 1 RPK as well as a FC > 10 ...
-
bioRxiv - Immunology 2021Quote: ... or goat anti-rabbit IgG (250 ng ml−1, 2.5% BSA in PBST; Dako, (Dako, P044801-2) at room temperature for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... or goat anti-rabbit IgG (250 ng ml−1, 2.5% BSA in PBST; Dako, (Dako, P044801-2) at room temperature for 1 h ...
-
bioRxiv - Neuroscience 2023Quote: ... and β-amyloid analysis (pretreatment with formic acid, antibody 4G8, DAKO, M087201-2, 1:100, 30 minutes). Tau pathology was assessed using Braak criteria (Braak et al ...
-
bioRxiv - Bioengineering 2022Quote: ... anti-mouse-IgG conjugated to horseradish peroxidase (1:10,000, cat. no. P016102-2; Dako, Carpinteria, CA, USA), anti-rabbit StarBright 700 (1:2500 ...
-
bioRxiv - Cell Biology 2024Quote: ... 3,3’-diaminobenzidine (DAB) substrate (Agilent Cat#GV82511-2 or GV92511-2), Dako REAL Peroxidase-blocking reagent (Agilent S202386-2) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The hybridisation mix was prepared by mixing the specified amounts of RNA with 10× Gene Expression Blocking Agent (1× final conc.) and 2× Hi-RPM Hybridization Buffer (1× final conc.) (Agilent, Cat No. 5188-5242) in a final volume of 42 μl ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...