Labshake search
Citations for Agilent :
101 - 150 of 4115 citations for 6 AMINO 4H 7H 1 3 DITHIINO 5 4 D PYRIMIDIN 8 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Next day membranes were washed for 3 x 5 min and incubated with HRP-coupled secondary antibodies (DAKO) diluted 1:3000 in washing buffer for 1.5 hour at RT ...
-
bioRxiv - Genetics 2023Quote: ... slides were carefully rinsed 3 × 5 min with PBS and slides were mounted with Fluorescent Mounting Medium (Dako) and examined under fluorescence using a Zeiss microscope equipped with an AxioCam HRm camera.
-
bioRxiv - Cell Biology 2020Quote: ... for amino acids and an Eclipse Plus C18 (1.8 μm; Agilent) for TCA and PPP intermediates ...
-
bioRxiv - Physiology 2021Quote: Amino acid concentrations were determined with high-performance liquid chromatography (Agilent Technologies 1100 HPLC System ...
-
bioRxiv - Molecular Biology 2019Quote: ... Tryptic peptides were re-dissolved in 10 μl 5% formic acid and 6 μl was injected onto a 50 mm 300 μm C18 trap column (Agilent Technologies) followed by an initial wash step with Buffer A (5% (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... using miR30-adapted sequences (5-6 shRNAs per target) by PCR-cloning a pool of oligonucleotides synthesized on 55k customized arrays (Agilent Technologies) using a well-established system 84–87 ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... The following primary antibodies were used: guinea pig anti-insulin 1:6 (Agilent, IR002), rabbit anti-glucagon 1:200 (Cell Signaling Technology ...
-
bioRxiv - Plant Biology 2020Quote: ... equipped with a 80/100 alumina column (1/8” x 2 mm x 1.5 m, Agilent) and set with the following parameters ...
-
bioRxiv - Immunology 2019Quote: ... pH 6 (Dako Cytomation) and set to 125°C with 30 s at the maximal pressure set to 10 psi ...
-
bioRxiv - Cancer Biology 2021Quote: ... pH 6 (Dako, S2367) in a microwave for 25 min ...
-
bioRxiv - Immunology 2020Quote: ... CK5/6 (Dako/IR780), p40 (Zytomed/MSK097) ...
-
bioRxiv - Bioengineering 2022Quote: ... 8 µm HPLC column (Agilent Technologies). Samples of culture supernatants were diluted twice with milliQ water with 50 mM H2SO4 ...
-
bioRxiv - Genetics 2023Quote: ... or goat serum (DAKO, cat.no.X090210-8), followed by incubation with primary antibody (overnight ...
-
bioRxiv - Bioengineering 2023Quote: ... 8 µm HPLC column (Agilent Technologies). Analyses were performed using the following conditions ...
-
bioRxiv - Microbiology 2021Quote: ... the fractions were injected on HPLC for purification performed on an Eclipse+ C18 column (L = 150 mm, D = 3.0 mm, Particles diameter 5 µm) (Agilent, Waldbronn, Germany). The volume injected was 100 µl ...
-
bioRxiv - Cancer Biology 2021Quote: ... before staining at a previously optimised dilution (BCL-xL 1:500; cleaved Caspase 3 1:500; MCL-1 1:200) and visualised with Liquid DAB (Agilent, UK). Ki67 (Agilent #M7240 ...
-
bioRxiv - Cancer Biology 2019Quote: ... anti-Mouse Envision-HRP (DAKO, one hour) as secondary antibody ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... closed with one-component-closure-caps (Agilent) at -80°C ...
-
bioRxiv - Bioengineering 2021Quote: ... pCS2-GemininΔ27-GFP was generated by deleting amino acids 1-27 from Geminin-GFP [27] using QuikChange® Lightning mutagenesis kit (Agilent, 210513). The plasmids pCS2-Flag-FA-Geminin-GFP w.t and Δ27 variant were generated by cloning Geminin-GFP into pCS2-Flag-FA vector sing FseI and AscI restriction sites ...
-
bioRxiv - Synthetic Biology 2021Quote: 384 well qPCR reaction plates for the multiplexed activation of endogenous genes (Figure 5 and 6) were set up using the Brilliant II SYBR master mix (Agilent cat #600828) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... RT was performed with a specific primer (5′-CCTACACGACGCTCTTCC-3′) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). RNA degradation was performed by incubating the RT mixture with 10% 1 M NaOH (2μl of RT mixture ...
-
bioRxiv - Immunology 2023Quote: ... Images were acquired (1-5 images per subject) using the Cytation 5 Cell Imaging MultiMode Reader (Agilent). Images were processed to quantify fluorescence intensity using Gen5 software package 3.08.
-
bioRxiv - Microbiology 2022Quote: ... 30 sec at 60°C (steps 3 and 4 were repeated 40 times) was done with the AriaMX real-time PCR System (Agilent).
-
bioRxiv - Microbiology 2023Quote: ... Amino acid analysis was performed by high-pressure liquid chromatography (HPLC) (Agilent 1100 ...
-
bioRxiv - Biophysics 2022Quote: ... Amino acid analysis was performed on an Agilent 1260 HPLC (Agilent Technologies) equipped with a fluorescence detector using automated o-phtalaldehyde/2-mercaptopropionic acid (OPA/MPA ...
-
bioRxiv - Microbiology 2021Quote: ... D.03.00.611 (Agilent Technologies). Retention times were related to an injected Kovats linear alkane mixture of carbon chain length C8-C40 and linear retention indices for each peak were calculated (van Den Dool and Dec ...
-
bioRxiv - Neuroscience 2022Quote: ... and goat-anti-mouse IG (Dako, P0447, 1:3000 in 3% milk) antibodies were used ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Mouse Anti-Enterovirus Clone 5-D8/1 (Dako M7064) to identify CVB VP1 region ...
-
bioRxiv - Neuroscience 2024Quote: ... 10ug of total synaptosomal protein was plated in each well of a polyethyleneimine coated 96 well plate (n=5-6/animal) and analyzed using the MitoStress kit from Agilent (Santa Clara, CA). The MitoStress kit measures oxygen consumption rate (OCR ...
-
bioRxiv - Immunology 2024Quote: ... Cells (1-2 × 105) were plated in Poly-D-Lysine coated 96-well microplates (Agilent) with 4-5 technical replicates ...
-
bioRxiv - Molecular Biology 2020Quote: Per2AS variant 2 overexpression plasmid was generated from 5’RACE and 3’RACE products that were cloned in to pBluescript (Agilent), as well as Per2AS qPCR product cloned into pGEM-T (Promega) ...
-
bioRxiv - Genetics 2021Quote: ... Additional sequences were added to the 5’ (ACTGGCCGCTTGACG-) and 3’ (-CGCAGGAGCCGCAGTG) ends of each fragment and synthesized in a 100K pool by Agilent Technologies (Supplementary Table S2) ...
-
bioRxiv - Biochemistry 2020Quote: ... Selected mRNAs were purified and reverse-transcripted into single-chain DNA with the primer 5’-CTTCAGTTGCCGCTTTCTTTCTTG-3’ using a reverse transcriptase (Cat 200436, Agilent). The resulting cDNA library was purified using a DNA purification kit (Cat A740609.25 ...
-
bioRxiv - Cell Biology 2020Quote: ... were changed to 5′-ACCTGCAAAG −3′ by using the Quick-Change site directed mutagenesis Kit (Stratagene, La Jolla, CA, USA). Expression vectors for SENP2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... The cells were washed 3 times with PBS for 5 min and then incubated with a secondary antibody: Flex-HRP (EnVision System, Dako) for 30 min and washed 3 times 5 min with PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Systems Biology 2019Quote: ... 8×60K (v21) microarray slides (Agilent, UK) according to Agilent microRNA Hybridization Kit protocol (Agilent ...
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Cancer Biology 2019Quote: ... citrate pH 6 (Agilent Technologies). Slides were immersed with blocking solution (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... CK5/6 (IR 780, Dako), CK8 (35bH11 ...
-
bioRxiv - Systems Biology 2023Quote: DNA oligonucleotide libraries (one for functional screen and one for massively parallel mutagenesis analysis) consisting of 7500 sequences total were synthesized by Agilent. The second strand was synthesized using Klenow Fragment (3’ → 5’ exo- ...
-
bioRxiv - Cell Biology 2019Quote: ... one XFp Extracellular Flux Cartridge (Agilent Cat. #102983) was hydrated with Agilent Seahorse XF Calibrant (Agilent Cat ...
-
bioRxiv - Cell Biology 2019Quote: ... One Agilent cell culture miniplate (Agilent Cat. #102984) was coated with Corning Cell-Tak Cell and Tissue Adhesive (Corning Cat ...
-
bioRxiv - Genetics 2020Quote: ... Oligos were purchased as one pool from Agilent Technologies.