Labshake search
Citations for Agilent :
151 - 200 of 5023 citations for 6 9 Ethano 4H imidazo 4 5 d pyridazino 1 2 a pyridazin 4 one 2 butyl 3 6 7 8 9 11 hexahydro 6 9 dimethyl 3 2' 2H tetrazol 5 yl 1 1' biphenyl 4 yl methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... or anti-GFAP (#Z03340-2, Agilent, 1:500). Visualizations of the primary antibodies were achieved using suitable secondary antibodies conjugated with Alexa fluorophores (Alexa Fluor 488 ...
-
bioRxiv - Neuroscience 2024Quote: ... or anti-GFAP (#Z03340-2, Agilent, 1:500). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: ... and GFAP rabbit (1:500, DAKO, Z033429-2) were used ...
-
bioRxiv - Genomics 2023Quote: ... and GFAP (1:1000, Rabbit, DAKO, Z033401-2). Following primary antibody incubation sections were washed 4x2 minutes with TBST and stained with species-appropriate secondary antibody conjugated to a Horseradish Peroxidase (HRP ...
-
bioRxiv - Neuroscience 2024Quote: ... For GFAP (1:1000, Agilent Technologies, Z033429-2), Iba1 (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-deoxy-d-glucose (50 mM 2-DG, Agilent Technologies) as a glycolysis inhibitor ...
-
bioRxiv - Cell Biology 2021Quote: ... sections were incubated for 2 hours at room temperature with polyclonal guinea pig anti-insulin antibody (1:5, Agilent Technologies). Slides were then washed 3 x 5 minutes with PBS and incubated with the Anti-guinea pig IgG Alexa Fluor 488 (1:200 ...
-
bioRxiv - Developmental Biology 2023Quote: ... with a KpnI site inserted at the 5’ end of Δ3-1 or Δ3-2 (Quick Change Site-Directed Mutagenesis from Stratagene) using the oligonucleotides Δ3-1-KpnI Fw ...
-
bioRxiv - Physiology 2019Quote: ... Heat-induced antigen retrieval was performed in citrate buffer (pH 9, Dako, USA). The sections were incubated with rabbit polyclonal SDF-1 antibody (sc-28876 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Antigen retrieval was performed in Dako pH 9 EDTA buffer (Dako, Kyoto, Japan) with a microwave ...
-
bioRxiv - Cancer Biology 2020Quote: ... by immersing glass slides in Antigen Target Retrieval Solution pH 9 from Dako during 40 min at 95°C ...
-
bioRxiv - Systems Biology 2021Quote: ... Antigen retrieval was conducted using Target Retrieval Solution pH 9 (Dako, cat # S2367) diluted 1:10 and heated for 60 minutes at 90 °C ...
-
bioRxiv - Biophysics 2023Quote: ... Antigen retrieval was obtained by boiling in Dako Target Retrieval (pH 9) (Dako) for 30 min in a steamer at 98°C ...
-
bioRxiv - Cancer Biology 2023Quote: Murine glioma cells (similar low passage N1IC-1/2 and p53-1/2) were seeded in PLL coated XFe24 cell culture microplates (Agilent TEchnologies) at 1.8ᵡ104 cells per well in 250μL BFP (n=10 technical replicates for the baseline experiment and n=5 technical replicates for the cysteine/methionine deprivation experiment ...
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Developmental Biology 2021Quote: ... A rabbit anti-GFAP (Dako # Z033401-2, 1:250) primary antibody was diluted in blocking solution for incubation at 4°C overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... Mouse anti-Ki67 (1:400, M724029-2, Agilent, UK) was used to label proliferative cells and rabbit anti-cleaved-Caspase3 (1:40 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ki-67 (M7240) (M724029-2, Agilent, 1:400 dilution), γH2AX (phospho-S139 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse clone CR3/43 (1:20, Agilent, M077501–2). Sections were incubated for 1 hour at room temperature with secondary antibodies (1:1000) ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-MPO (1:200, A039829-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-CD3 (1:200, A045229-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Neuroscience 2022Quote: ... GFAP (1:500, Z033429-2, Agilent, Santa Clara, CA), and IBA1 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse monoclonal anti-PCNA (1:300; M087901-2 Agilent); guinea pig polyclonal anti-Doublecortin (DCX ...
-
bioRxiv - Neuroscience 2023Quote: ... or Aβ (Dako, code: M087201-2; 1:40 dilution), together with hematoxylin ...
-
bioRxiv - Developmental Biology 2024Quote: ... rabbit anti-Lysozyme (Agilent, cat.# A009902-2; 1:300), rabbit anti-Aldolase B/C (Abcam ...
-
bioRxiv - Microbiology 2024Quote: ... anti Ki67 (Agilent DAKO, M724029-2, dilution 1:200), anti-pSTAT-1 (Cell Signalling ...
-
bioRxiv - Microbiology 2024Quote: ... anti Ki67 (Agilent DAKO, M724029-2, dilution 1:200), anti-pSTAT-1 (Cell Signalling ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-GFAP rabbit (Agilent Cat# 033401-2; 1:1000 ICC, 1:1000 IHC), anti-GFAP chicken (Encorbio Cat# CPCA-GFAP ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Barcoded cDNA libraries containing 5-6 LMD samples plus a Universal Human Reference RNA (UHR) standard (Stratagene) were prepared on the Ion Chef System using the Ion Ampliseq Chef DL8 materials and the Ion AmpliSeq Transcriptome Human Gene Expression Panel Chef-ready Kit (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2019Quote: ... citrate pH 6 (Agilent Technologies). Slides were immersed with blocking solution (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... CK5/6 (IR 780, Dako), CK8 (35bH11 ...
-
bioRxiv - Immunology 2020Quote: ... RNA integrity number (RIN) exceeded 9 for all samples measured by 2100 Bioanalyser (Agilent). RNASeq libraries where prepared using Smartseq2 as described by Picelli et al (64) ...
-
bioRxiv - Cancer Biology 2022Quote: ... tissues were rehydrated and cooked in DAKO Target Retrieval Solution pH 9 (#S236784, DAKO) for 20 min in microwave at ~600W ...
-
bioRxiv - Cell Biology 2023Quote: ... All samples had RIN scores greater than 9 (Agilent 4150 TapeStation System, G2992 AA) and underwent polyA-selection and stranded library preparation prior to sequencing at 150 paired end reads (Genewiz from Azenta Life Sciences) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and an RNA integrity number ≥ 9 was assessed by TapeStation RNA Screen Tape (Agilent). RNA-seq analysis was performed with the transcriptome for targeted next-generation sequencing by Macrogen (Tokyo ...
-
bioRxiv - Immunology 2023Quote: ... Heat induced epitope retrieval (HIER) was conducted using target retrieval solution pH 9 (Dako S236784-2 ...
-
bioRxiv - Immunology 2022Quote: ... CF (R&D/BT10500-050) was incubated at a 4:1 molar ratio with either streptavidin-PE (Prozyme PJRS25) or streptavidin-APC (Prozyme PJ27S ...
-
bioRxiv - Cancer Biology 2022Quote: 2×104 – 4×104 cells per well were plated onto a Seahorse XFe96 FluxPak plate (Agilent, 102416-100). On the day of the assay ...
-
bioRxiv - Synthetic Biology 2021Quote: 2-methyl tryptophan was quantified by an LC-MS system (Agilent) using an XBridge BEH Amide 2.5 μm (Waters ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were washed and incubated with rabbit anti-goat IgG (500 ng ml−1, 5% milk in PBST; Dako, P044901-2), rabbit anti-mouse IgG (1.3 μg ml−1 ...
-
bioRxiv - Plant Biology 2019Quote: ... 1/4 pear sections from 4 fruits per replicate) were injected into a HP 5890A gas chromatograph (Agilent, Avondale, PA, USA) with a flame ionization detector (FID ...
-
bioRxiv - Molecular Biology 2021Quote: ... at 4°C overnight diluted 1:200 in antibody diluent (#S3022, Dako). Negative controls were incubated with antibody diluent only ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sections were incubated at 4°C with anti-VWF (1:200, Dako) and anti-α-smooth muscle actin (1:100 ...
-
bioRxiv - Neuroscience 2024Quote: ... PSCs were then labeled with a S100 rabbit antibody (1:4, DAKO) for 2 h at RT ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2022Quote: ... HRP-conjugated rabbit anti-mouse (Agilent, P0260022-2, 1:3000).
-
bioRxiv - Developmental Biology 2022Quote: ... HRP-conjugated rabbit-anti-goat (Agilent, P016002-2; 1:3000), HRP-conjugated rabbit anti-mouse (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... HRP-conjugated goat-anti-rabbit (Agilent, P044801-2; 1:3000), HRP-conjugated rabbit-anti-goat (Agilent ...