Labshake search
Citations for Agilent :
1 - 50 of 3728 citations for 6 4 METHOXY PHENYL 3 PYRIDIN 3 YL PYRAZOLO 1 5 A PYRIMIDINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Physiology 2019Quote: ... After 3 wash steps (Dako wash buffer, 5 min each). Sections were incubated with 3,3’-diaminobenzidine (DAB ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Molecular Biology 2024Quote: ... HP-5 MS column (5% phenyl methyl polysiloxane: 30m x 0.25mm i.d. x 0.25 µm, Agilent technologies) was used for metabolite separation ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2019Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation ...
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3-4 μm slides were cut and stained for MLH1 (Monoclonal Mouse Anti-Human; Clone ES05, dilution 1 : 10,Dako), MSH2 (Monoclonal Mouse Anti-Human ...
-
bioRxiv - Microbiology 2021Quote: ... Tissue sections were colored via DAB-staining (3, 3-diaminobenzidine; Dako, K3468).
-
bioRxiv - Biochemistry 2020Quote: ... 50 Pulsed-splitless injection was used to inject 5 μL samples onto an HP-5ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-Diaminobenzidine (DAB, Agilent) and then counterstained with haematoxylin (Abcam) ...
-
bioRxiv - Cell Biology 2019Quote: Cleaved Caspase-3 staining required 5 minute treatment with Target Retrieval Solution (DAKO S1700), 1 hour room temperature incubation with Cleaved Caspase-3 (Asp175 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... n-dodecane samples were subjected to the Agilent 6890N gas chromatograph equipped with a (5%-phenyl)-methylpolysiloxane HP-5 column (length, 30 m; inside diameter, 0.32 mm; film thickness, 0.25 mm; Agilent Technologies, Ratingen, Germany) and a flame ionization detector (FID) ...
-
bioRxiv - Cancer Biology 2023Quote: ... in 3 cycles for 3 hours using the Seahorse XFe24 analyzer system (Agilent Technologies). Inhibitors and substrates were used at the following concentrations ...
-
bioRxiv - Bioengineering 2021Quote: ... The GC-MS system used was the 7890-5975C from Agilent in combination with the HP-5MS column (5% phenyl methyl polysiloxane, 30m×0.25mm ID, 0.25µm) from Agilent. The temperature was maintained at 180 °C for 1 min ...
-
bioRxiv - Plant Biology 2020Quote: ... equipped with a 5% phenyl-polymethylsiloxane capillary column (DB-5MS, 30 m × 0.25 mm × 1.0 μm; Agilent).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... ON) mass spectrometer using a Eclipse Plus phenyl hexyl column (4.6 A 100mm, 5 µm column, Agilent) and 1290 Infinity II inline filter (0.3 µm) ...
-
bioRxiv - Developmental Biology 2019Quote: ... service pack 3 (Agilent Technologies).
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm column (Agilent), column temperature 50 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... Lipids were resolved on a 3 150 mm XDB-C8 column (5 μM particle size) (Agilent) at flow rate 0.4 mL/min ...
-
bioRxiv - Molecular Biology 2020Quote: ... with a specific primer (5’-CCTACACGACGCTCTTCC-3’) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). Then ...
-
bioRxiv - Cell Biology 2021Quote: ... One microliter of the derivatized samples was injected into an Agilent 6890 GC interfaced to an Agilent 5973 quadrupole MS with a HP-5ms (5%-Phenyl)-methylpolysiloxane column (30 m × 0.25 mm × 0.25 μm, Agilent) in splitless mode ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Neuroscience 2022Quote: ... and goat-anti-mouse IG (Dako, P0447, 1:3000 in 3% milk) antibodies were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 3-diaminobenzidine (DAB) solution (Dako, USA) until signal was detected ...
-
bioRxiv - Cancer Biology 2022Quote: ... and KI67 (clone TEC-3, Dako) were then incubated on the tissue slices and bound antibody was detected with biotinylated goat anti-rat IgG (Southern Biotechnology) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-diaminobenzidine tetrahydrochloride (DAB; Dako, K3467), as chromogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ diaminobenzidine (DAB) (Dako, Carpinteria, CA) and counter-staining was done with hematoxylin ...
-
bioRxiv - Biochemistry 2023Quote: ... or a BIOSEC 3 column (Agilent; flow rate ...
-
bioRxiv - Microbiology 2020Quote: ... Separation occurred with a HP-5 ms capillary column coated with 5% phenyl-95% methylpolysiloxane (30 m×250 µm i.d., 0.25 µm film thickness, Agilent Technologies).
-
bioRxiv - Plant Biology 2019Quote: ... An HP-5MS capillary column (5%phenyl-methyl-siloxane, 30-m, 250-mm, and 0.25-mm film thickness; Agilent) was used with helium carrier gas at 2 mL/min ...
-
bioRxiv - Plant Biology 2021Quote: Quantitative analysis was performed using a HP-5MS capillary column (5% phenyl-methyl-siloxane, 30 m x 250 mm, 0.25 mm film thickness; Agilent) with helium carrier gas at 1.5 mL/min ...
-
bioRxiv - Plant Biology 2024Quote: ... The organic phase was dried using anhydrous MgSO4 and analysed on GC-2010 Pro gas chromatograph (Shimadzu, Japan) equipped with an HP-5MS 30 m × 0.25 mm (5%-Phenyl)-methylpolysiloxane column (19091S-133, Agilent) with nitrogen as the carrier gas with splitless injection mode ...
-
bioRxiv - Microbiology 2023Quote: ... Poroshell 120 Phenyl Hexyl column (Agilent Technologies, USA) was used for separation ...
-
bioRxiv - Cancer Biology 2021Quote: ... The labeled complementary RNAs were hybridized onto a whole human genome oligo microarray (4 3 44K; Agilent Technologies). After washing the slides ...
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...