Labshake search
Citations for Agilent :
451 - 500 of 2943 citations for 6 1 Azepanyl 3 pyridinamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... then was injected to online SEC-SAXS equipped with a temperature-controlled (15 °C) silica-based SEC column (Agilent BioSEC-3)32 ...
-
bioRxiv - Cancer Biology 2021Quote: ... endogenous peroxidase activity was blocked by incubation with 3% H2O2 / Methanol for 10 minutes followed by incubation with Dako Dual Endogenous Enzyme Block reagent (Agilent Dako, S2003) for 30 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... heat mediated antigen retrieval was performed for 3 min at 125°C in citrate pH 6.0 target retrieval solution (Dako Cat# S2369) using a decloaking chamber (Biocare Medical) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plates were read at 450 nm and 560 nm wavelengths using a BioTek Cytation 3 Cell Imaging Multi-Mode Microplate Reader (Agilent Technologies). Plasma samples isolated from retroorbital bleeds were used for ProcartaPlex immunoassays (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... Scanning of microarrays was performed with 3 μm resolution (8×60K) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were processed with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were subsequently diluted to adjust the HNO3 concentration to 3 % and ICP-MS was performed with a Hewlett-Packard 4500 ICP mass spectrometer (Agilent Technologies) connected to a CETACASX-500 auto-sampler for sample injection ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were injected into a C18 reverse phase column (Atlantis T3, 2.1 × 150 mm, 3 μm; Waters) using HPLC (Agilent 1290 LC) at a flow rate of 0.15□ml/min with 5 mM ammonium formate for mobile phase A and 100% methanol for mobile phase B ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR was performed in technical triplicates from at least 3 independent biological samples using the SYBR green Brilliant II fast kit (Agilent Technologies) on an Mx3005p apparatus (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Plant Biology 2023Quote: ... The samples were homogenized and the supernatant was loaded onto a Bond Elut C18 cartridge (100 mg, 3 ml; Agilent Technologies) and eluted with 80% (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... (3) RNA integrity was assessed using the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA).
-
bioRxiv - Bioengineering 2023Quote: ... PHA was extracted from lyophilized sludge using acidified methanol (3% sulfuric acid) containing chloroform and analyzed using a gas chromatography-mass spectrometry (Agilent, USA). Glycogen in sludge was extracted in a similar way but using 0.9M HCl and analyzed using a liquid chromatography-mass spectrometer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was cross-linked by exposing the living cells twice to 4,5′,8-trimethylpsoralen at a final concentration of 10 μg/mL followed by 3’ irradiation pulses with UV 365-nm monochromatic light (UV Stratalinker 1800, Agilent Technologies). The cells were then washed repeatedly with cold PBS and lysed with a cell lysis buffer (1.28M sucrose ...
-
bioRxiv - Biophysics 2023Quote: ... The monodisperse sample solutions of proteins were injected onto a size exclusion column (David and Perez 2009) (SEC-3, 150 Å; Agilent) using an Agilent HPLC system and eluted into the capillary cell at a flow rate of 0.3 ml min-1 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The slides were then treated with 3% hydrogen peroxide for 10 min and then blocked with Serum-Free Protein Block (Dako, X0909) for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pooled library was quality checked on an Agilent TapeStation System by mixing 3 µL D1000 Sample Buffer (Agilent 5190-6502) with 1 µL pooled library and running in D1000 ScreenTape (Agilent 5067-5582) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and absorbance was measured at 562 nanometers using the Bio-Tek Cytation 3 Multi-Mode Reader (Agilent, Santa Clara, CA, USA). The proteins were run on a 10% SDS-polyacrylamide gel ...
-
bioRxiv - Physiology 2023Quote: ... The metabolic function of activated CD4+ T cells cultured for 3 days in vitro was analyzed by measuring the extracellular acidification rate (ECAR) using an XFe96 extracellular flux analyzer (Seahorse Bioscience). The cells were kept in XF media (Seahorse Bioscience ...
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Neuroscience 2020Quote: ... GFAP (1:200, rabbit, Dako; 1:1000, chicken, Millipore), MBP (1:500 ...
-
bioRxiv - Cancer Biology 2019Quote: ... clone MIB-1 (diluted 1:100; DAKO, Carpinteria, CA) at 4°C overnight ...
-
bioRxiv - Pathology 2020Quote: ... anti-HER2 (1:400 to 1:600, DAKO, Denmark), anti-PR antibody (DAKO ...
-
bioRxiv - Neuroscience 2023Quote: ... Iba1 (1:1,000, Wako) and GFAP (1:1,000, Dako) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... or humanized Renilla luciferase (5’-CCC CGA GCA ACG CAA AC-3’ and 5’-GCA CGT TCA TTT GCT TGC A-3’) and in 1x Brilliant III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent Technologies). The reaction and fluorescence readout were performed in Rotor-Gene 6200 (Corbett Life Science ...
-
bioRxiv - Bioengineering 2019Quote: ... Removal of the native splice acceptor in the 3’ homologous arm of HDR templates was achieved via site-directed mutagenesis (Agilent Technologies, 200523).
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were washed in TBST (3 × 15 mins at RT) and then incubated with corresponding peroxidase-conjugated secondary antibodies (Dako, P0447, P0448) for 1h at RT ...
-
bioRxiv - Cancer Biology 2020Quote: ... was performed on 3-μm thick tissue sections using split signal FISH DNA probes for BCL2/18q21 (probe Y5407; DAKO A/S), BCL6/3q27 (probe Y5408 ...
-
bioRxiv - Bioengineering 2019Quote: ... Then endogenous peroxidase block was performed by using 3% H2O2 in water to cancel the interference of peroxidase in the final step.[33] Protein block buffer (Dako Protein Block) was used to treat the tissue slides to mask the non-specific binding sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were finally washed for 3 × 10min with PBS before mounting them on glass coverslips with Dako fluorescence conserving media (Dako, Hamburg, Germany).
-
bioRxiv - Cell Biology 2021Quote: ... followed by incubation with 3% hydrogen peroxide to quench endogenous peroxidase activity and 15 minutes in serum-free protein block (DAKO, Glostrup, Denmark). Sections were then subjected to appropriate antigen retrieval methods (if needed ...
-
bioRxiv - Cancer Biology 2020Quote: To construct RNA-seq libraries from C.elegans samples, we used an automated QuantSeq 3’mRNA-seq (Lexogen GmbH, Vienna) using the Agilent NGS Workstation (Agilent Technologies, Santa Clara) as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... All immunostains were performed in Ventana Discovery (Ki-67 and cleaved caspase 3) or Dako autostainers using 3,3’ diaminobenzidine (DAB) chromogen (Dako-Agilent Technologies, Denmark). All slides were scanned using digital slide scanner NanoZoomer-XR C12000 (Hamamatsu ...
-
bioRxiv - Cell Biology 2020Quote: ... embryos were washed 3 times in PBV and transferred onto a glass microscope slide with DAKO mounting medium (Dako Inc., Carpinteria, California) and enclosed with a coverslip using a spacer (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA libraries were assessed for quality and quantification according to the Chromium Single Cell 3’ Reagent kit v3 user guide using the High Sensitivity D5000 ScreenTape (Agilent 5067-5592) and 2200 TapeStation Controller software (Agilent ...
-
bioRxiv - Cell Biology 2022Quote: ... and antisense primer (5’-GGA GAA AGG CAC CTG CCA GGC CTC AAC-3’) by site-directed mutation according to manufacturer’s protocol (QuikChange II XL Site-Directed Mutagenenesis Kit, 200521; Stratagene, LA Jolla, CA). The primers were designed to delete (in frame ...
-
bioRxiv - Neuroscience 2020Quote: ... the sample quality was checked with both the Qubit 3 Fluorometer and the High Sensitivity D1000 ScreenTape assay (Agilent Technologies #5067-5584). The libraries were equimolarly pooled ...
-
bioRxiv - Biochemistry 2021Quote: ... The digestion and desalting (total time 3 min) were driven by 0.4% formic acid (FA) in water pumped by 1260 Infinity II Quaternary pump (Agilent Technologies, Waldbronn, Germany) at a flow rate of 100 μL·min−1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... slices were then incubated with anti-cleaved caspase 3 antibody or anti-Ki67 antibody (Cell Signalling) and further processed with secondary antibody (LSAB2 horseradish peroxidase kit; Dako, Copenhagen, Denmark).
-
bioRxiv - Immunology 2019Quote: A deleted version of pNL4-3 was constructed (18) that lacks the entire Gag and Protease region (Stratagene Quick-Change XL kit) replacing this region with a BstE II (New England Biolabs ...
-
bioRxiv - Biochemistry 2020Quote: ... Thirty-six metabolites were from a list of potential biotransformation products directly derived from HGA and compiled using the Biotransformation Mass Defects application (Agilent; Appendix 3). This tool provides a list of potential metabolic biotransformation products covering both phase I (n=19 ...
-
bioRxiv - Cancer Biology 2021Quote: ... endogenous peroxidase activity was blocked by incubation with 3% H2O2 / Methanol for 10 minutes followed by incubation with Dako Dual Endogenous Enzyme Block reagent (Agilent Dako, S2003) for 30 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... E706A/E1015A and E437A/E706A/E1015A=EallA) were obtained by site-directed mutagenesis of pCS2-3×HA-NFATc3 using the QuickChange® II XL kit (Agilent Technologies) using the indicated primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... the 3 liver cancer specimens also underwent bulk-level WES using Agilent SureSelect Human All Exon v7 K it (Agilent, 5191-4005) and illumina NovaSeq 2 × 150 bp sequencing mode ...
-
bioRxiv - Biochemistry 2023Quote: Prior to LCMS analysis the TIMSTOF SCP was freshly tuned using the OTOF Control engineering software with an infusion of 3 μL/min of low-concentration tuning mix (Agilent, G1969-85000). Autotuning was performed for sensitivity and resolution tuning was manually checked ...
-
bioRxiv - Biochemistry 2023Quote: Prior to LCMS analysis the TIMSTOF SCP was freshly tuned using the OTOF Control engineering software with an infusion of 3 μL/min of low-concentration tuning mix (Agilent, G1969-85000). Autotuning was performed for sensitivity and resolution tuning was manually checked ...
-
bioRxiv - Systems Biology 2023Quote: ... Membranes were washed 3 times with TBST for 10 min at room temperature and incubated with horseradish peroxidase coupled secondary antibodies (Dako, P0448/P0447) at room temperature for 1 h (1:2000 in 0.3% (w/v ...