Labshake search
Citations for Agilent :
201 - 250 of 3841 citations for 6' ETHYL SPIRO 1 3 DIOXANE 2 3' INDOLIN 2' ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Genetics 2020Quote: ... Captured libraries were amplified in 3×100 μl reactions containing 1 unit Herculase II Fusion DNA polymerase (Agilent), 1x Herculase II reaction buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were incubated overnight at 4° C with primary antibodies (mouse-anti-Ataxin-3, 1:2500, clone 1H9, MAB5360, MerckMillipore, Darmstadt, Germany; rabbit-anti-Ubiquitin, 1:500, Z0458, Dako, Jena, Germany). After washing the membranes were incubated with secondary antibodies (peroxidase affinePure donkey anti-mouse IgG H+L ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM Sodium Pyruvate (Agilent, 103578), and 1 mM Glutamine (ThermoFisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... PECAM1/CD31 (Agilent Technologies, M082329-2), PECAM1/CD31 (R&D Systems ...
-
bioRxiv - Neuroscience 2020Quote: ... Hematoxylin (Agilent Technologies; Cat S330930-2) was pipetted onto each section until completely covered and incubated for 7 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... GFAP (1.45μg/ml; Z033401-2; DAKO) and Ki67 (0.084μg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2022Quote: ... CD3 170Er (polyclonal, A045229-2, Dako), CD4 156Gd (clone EPR6855 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-SMA (M085129-2, Agilent). Anti-Perlecan antibody was a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... or anti-S100A1antibody (Dako, Z031129-2). Immunostained slides were counterstained with hematoxylin (Sigma) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...
-
bioRxiv - Cancer Biology 2021Quote: ... Low pH (Agilent Dako, S236984-2) in a PT Link instrument (Agilent Dako ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 μl of SureSelect probes (Agilent) were mixed with 2 μl of 25% RNAse block ...
-
bioRxiv - Immunology 2021Quote: ... HRP anti-Rabbit (Agilent, K400311-2) and EnVision+ Single Reagents ...
-
bioRxiv - Cancer Biology 2020Quote: ... High pH (Agilent DAKO, K800421-2). 1X EnVision FLEX Wash Buffer (Agilent DAKO ...
-
bioRxiv - Immunology 2020Quote: ... CD68 (Agilent, #GA60691-2, Clone KP1), Cleaved Caspase 3 (CST ...
-
bioRxiv - Bioengineering 2021Quote: ... anti-PMEL (Agilent Technologies, #M063429-2), anti-ACTA2 (Sigma-Aldrich #C6198) ...
-
bioRxiv - Genetics 2019Quote: ... coli bacteria (Sure 2, Agilent Technologies) were transformed with pFPV25.1 (Valdivia and Falkow 1996 ...
-
bioRxiv - Physiology 2023Quote: ... and 50mM of 2-DG (Agilent) were injected during the assay ...
-
bioRxiv - Cell Biology 2022Quote: ... clone D33 (Agilent Technologies M076029-2); western blot ...
-
bioRxiv - Systems Biology 2023Quote: ... Epoch 2 (BioTek, now: Agilent Technologies) or Infinite 200 Pro (TECAN trading AG ...
-
bioRxiv - Cancer Biology 2023Quote: ... High pH (Agilent DAKO, K800421-2) for DKC1 slides and EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cancer Biology 2023Quote: ... Low pH (Agilent DAKO, K800521-2) for Ki67 slides ...
-
bioRxiv - Cancer Biology 2023Quote: ... Low pH (Agilent DAKO, K800521-2) for Ki67 slides ...
-
bioRxiv - Cancer Biology 2023Quote: ... High pH (Agilent DAKO, K800421-2) for DKC1 slides and EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 10x AffinityScript buffer (Agilent), 2 μl 0.1 M DTT ...
-
bioRxiv - Pathology 2023Quote: ... stained with hematoxylin (S330130-2, Agilent) and stored at 4 °C ...
-
bioRxiv - Genomics 2022Quote: ... Mayer’s Hematoxylin (Agilent Technologies, S330930-2) was removed from each well and then each section was washed with 75µL of RNase and DNase free MQ water ...
-
bioRxiv - Physiology 2023Quote: ... and DAB (K346811-2; Agilent Technologies). Slides were counter stained with Mayer’s Hematoxylin (TA-125-MH ...
-
bioRxiv - Cancer Biology 2023Quote: ... protein blocker (Agilent Technology, X090930-2). Slides were incubated with a biotinylated anti-pimonidazole mouse IgG1 monoclonal antibody diluted 1:50 in Background Sniper (Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Rabbit Linker (Agilent Cat#GV80911-2). Epitope Retrieval Solution 1 (Leica Cat#AR9961) ...
-
bioRxiv - Cell Biology 2024Quote: ... ‘Normal’ block (Agilent Cat#S202386-2), EnVision FLEX TRS High pH (Agilent Cat# GV80411-2) ...
-
bioRxiv - Neuroscience 2024Quote: ... Tau Dako (Agilent Technologies, #A002401-2), C-Myc (Cell Signaling Tech ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM glutamine (Agilent 103579-100), and 10 mM glucose (Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM glutamine (103579; Agilent Technologies) and 1 mM sodium pyruvate (103578 ...
-
bioRxiv - Immunology 2023Quote: ... 2 and the QuikChangeII kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µl Herc II polymerase (Agilent), and 35 µl nuclease-free water were added to the 40 µl gDNA ...
-
bioRxiv - Microbiology 2024Quote: ... HRP kit (Agilent DAKO, K400111-2) or the EnVision+/HRP ...
-
bioRxiv - Microbiology 2024Quote: ... HRP kit (Agilent DAKO, K400111-2) or the EnVision+/HRP ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 mM L-glutamine (Agilent) and the cells were placed in a non-CO2 incubator set at 37°C for approximately 1 h before starting the assay ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 mM XF Glutamine (Agilent), and then cells were incubated in a CO2-free incubator for 1 hr ...
-
bioRxiv - Cancer Biology 2024Quote: ... Serum-Free (Agilent Dako, X090930-2) for 10 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... Serum-Free (Agilent Dako, X090930-2) for 10 minutes ...
-
bioRxiv - Immunology 2024Quote: ... 2 mM glutamine (Agilent, 103579-100), 10 mM glucose (Agilent ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Immunology 2022Quote: ... Samples were analyzed with a 3-laser flow cytometer (Agilent Novocyte) and data were processed with FlowJo (v10.1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luminescence was measured using a Cytation 3 Image Reader (Agilent). The luminescence of vehicle-treated controls was set to 100% ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luciferase activities were measured with Cytation 3 Image Reader (Agilent). Firefly luciferase activities were normalized to those of the Renilla luciferase.
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was quantified using the Gen5 Take 3 Module (Agilent BioTek) and assessed for quality with 260/230 absorbance ratio ...