Labshake search
Citations for Agilent :
151 - 200 of 4474 citations for 5 Pyrimidinecarbonitrile 1 2 3 4 tetrahydro 4 oxo 6 phenyl 2 thioxo since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... For 8 other samples (1 normal and 3 tumor regions each from 2 patients) only DNA was isolated and targeted panel sequencing (Agilent SureSelect run on a HiSeq) was performed for 257 genes ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Cancer Biology 2019Quote: ... Both the trap (Dr Maisch Reprosil C18, 3 μm, 2 cm x 100 μm) and the analytical (Agilent Poroshell EC-C18 ...
-
bioRxiv - Microbiology 2020Quote: ... The derivatized samples were analyzed on an Agilent GC-MS (GC model 7890A, MS Model 5975C) equipped with a (5% phenyl)-methylpolysiloxane capillary column (Agilent model HP-5MS). The injection port temperature was held at 280 °C and the oven temperature program was held at 80 °C for 1 min ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Scanning of microarrays was performed with 5 μm resolution and XDR extended range (4×44K arrays) or 3 µm resolution (8×60K arrays) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were analyzed and extracted with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Bioengineering 2024Quote: ... Bevacizumab-sensitive/resistant U87 cells were cultured identically to wild-type U87 cells.79 Cells were screened for mycoplasma every 3 – 4 months with the MycoSensor qPCR Assay Kit (Agilent Technologies).
-
bioRxiv - Molecular Biology 2023Quote: ... Silica beads functionalized with phenyl-boronic acid (Bondesil-PBA 40µm, Agilent) were used for glycopeptides enrichment at an optimized ratio of 1:2.5 sample:PBA beads w/w ...
-
bioRxiv - Microbiology 2021Quote: ... For replicates 1 and 2 a Strategene Mx3005P PCR machine (Agilent, USA) was used ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-Pan-Cytokeratin (1:100, M351529-2, Dako Agilent Pathology Solutions), rabbit anti-CD3 (1:200 ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-Pan-Cytokeratin (1:100, M351529-2, Dako Agilent Pathology Solutions), rabbit anti-CD3 (1:200 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were stained with primary antibodies CD31 (1:200, M082329-2, DAKO), NG2 (1:200 ...
-
bioRxiv - Immunology 2019Quote: ... followed by SA-HRP (1:2000 dilution #P030701-2, DAKO – CA, USA) and visualised with TMB (#421101 Biolegend – CA ...
-
bioRxiv - Immunology 2021Quote: ... followed by the addition of bluing buffer (Agilent, CS70230-2, 1 mL) and incubation at room temperature for 2 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... at 1:200 and anti-GFAP (Rabbit IgG polyclonal; Dako M076101-2). Secondary goat antibodies were Alexa Fluor conjugates (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: ... and glial fibrillary acidic protein (GFAP) staining (1/1000; Dako Z033429-2), fixed samples were rinsed at RT with PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (1:2,000; GA524; Z033401-2; Dako/Agilent Tech., CA); rat anti-GFAP (1:1,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-GFAP (1:2,000; GA524; Z033401-2; Dako/Agilent Tech., CA); rat anti-GFAP (1:1,000 ...
-
bioRxiv - Genetics 2023Quote: ... goat anti-rabbit IgG-HRP (1:3000, Agilent, cat no. P044801-2), for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... RRID:AB_2223021) were diluted 1:200 in Antibody Diluent (DAKO, cat.#S302283-2) and applied to cells overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... All other synthetic or expressed peptide substrates were purified and analyzed at small scale utilizing analytical-scale reverse-phase HPLC on an Agilent 1100 series HPLC system (Santa Clara, CA) employing an Eclipse Plus C18 column (5 μm, 4 × 150 mm) (Agilent) at a flow rate of 1 mL/min ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Cancer Biology 2022Quote: ... blocked for 1 hr in 2% BSA + 0.1% Tween20 + 1:50 normal goat serum (DAKO) in PBS and washed twice with PBS + 0.5% Tween ...
-
bioRxiv - Molecular Biology 2023Quote: ... goat anti-rabbit IgG (250 ng ml−1, 1% BSA in PBST; Agilent, P044801-2) or rabbit anti-goat IgG (500 ng ml−1 ...
-
bioRxiv - Bioengineering 2021Quote: ... and incubated overnight at 4 °C with primary antibodies: Anti-GFAP 1:1000 (Z0334, Dako), Anti-CD68 1:400 (MCA1957 ...
-
bioRxiv - Immunology 2019Quote: ... 4°C overnight followed by HRP conjugated goat-anti-rabbit IgG (#P0448, Dako (1:1000). α-Tubulin was used as a housekeeping control (#sc-32293 ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were rabbit (P044801-2) or mouse (P044701-2) HRP-conjugated (Dako, Agilent), used at 1:10000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary antibodies were rabbit (P044801-2) or mouse (P044701-2) HRP-conjugated (Dako, Agilent), used at 1:10000 dilution ...
-
bioRxiv - Genetics 2020Quote: ... Baseline respiration and maximal respiratory capacity were measured using the Seahorse instrument (XF24 data for Figure 2 and Xe96 data for figure 3) according to manufacturer’s instructions (Agilent). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... αIgG (Agilent Cat#A042402-2). Cells were cultured in RPMI-1640 (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Krt8/18 (DAKO M365201-2), GATA6 (R&D AF1700 ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent, Cat# Z033429-2) Stained sections with only secondary antibodies were used as controls ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent/Dako, Z033429-2), Lectin (Vector Labs ...
-
bioRxiv - Neuroscience 2021Quote: ... GFAP (Agilent/Dako, Z033429-2), Lectin (Vector Labs ...
-
bioRxiv - Systems Biology 2020Quote: ... pH 9 (Agilent, S236784-2) for 15 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 9 (Agilent, #S236784-2) at 97 °C for 10 min ...
-
bioRxiv - Physiology 2019Quote: ... ACC1/2 (DAKO DENMARK, P0397), phospho-ACC Ser212 (Millipore,03303).HDAC4 (7628 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... coli BL21 Rosetta 2 (Stratagene) by induction with 1 mM IPTG in 2X YT medium at 20°C overnight ...
-
bioRxiv - Physiology 2021Quote: ... DAB chromogen (Agilent, K346889-2) with hematoxylin counter stain (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... bluing buffer (Dako, CS70230-2) for 90 seconds and finally in Eosin Y (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... coli BL21 Rosetta 2 (Stratagene) using the plasmids described above by induction at OD600=0.8 with 1 mM IPTG in 2X YT (Streptavidin-GFP-GFP ...
-
bioRxiv - Physiology 2023Quote: ... 2 μM of FCCP (Agilent), and 0.5 μM of rotenone AA (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 2 mM glutamine (Agilent). Cells were allowed to attach at RT for 15 min and then transferred to a 37°C incubator without CO2 for 40 min ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 9.0 (Agilent, S236784-2) for 10 minutes was used for MMP13 and p16 antigen retrieval ...
-
bioRxiv - Physiology 2023Quote: ... and 2 mM pyruvate (Agilent) and the mitochondria concentration assessed by Pierce BCA Protein Assay (Thermo) ...
-
bioRxiv - Cell Biology 2024Quote: ... Diaminobenzidine (Agilent, Cat#K346811-2) was used as a chromogen and finally ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-BCL-2 (Dako #M0887) and anti-β-actin (EMD Millipore #MAB1501) ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 glutamine (Agilent #103579-100) in XF DMEM medium (Agilent #103575-100)] in atmospheric air at 37°C ...