Labshake search
Citations for Agilent :
351 - 400 of 4398 citations for 5 Pyrimidinecarbonitrile 1 2R 2 3 dihydroxypropyl 1 2 3 4 tetrahydro 3 methyl 2 4 dioxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-CD3 antibody at a dilution of 1:200 (A045229-2, Dako Agilent Pathology Solutions), rat monoclonal anti-CD45 antibody at a dilution of 1:100 (05-1416 ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-CD3 antibody at a dilution of 1:200 (A045229-2, Dako Agilent Pathology Solutions), rat monoclonal anti-CD45 antibody at a dilution of 1:100 (05-1416 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2% BSA in 0.1% PBS-Tx and stained with rabbit anti-human tau antibodies (1:1000; Dako) or mouse anti-phospho tau PHF-1 (1:1000 – thermofisher) ...
-
bioRxiv - Immunology 2021Quote: ... FcR binding was quantified by incubating immune complexes with biotinylated FcRs (FcγR2A-1, FcγR2A-2, FcγR3A, courtesy of Duke Protein Production Facility) conjugated to Steptavidin-PE (Prozyme). Flow cytometry was performed with an IQue (Intellicyt ...
-
bioRxiv - Immunology 2020Quote: ... consistently identified GFAP peptides while minimizing nonspecific off-target peptide identification (Agilent Z033429-2, 1:200 dilution). Each peptide was required to have a minimum of 1 RPK as well as a FC > 10 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The following primary antibodies and dilutions were used: guinea pig anti-Insulin (1:6, Dako, IR00261-2), mouse anti-Glucagon (1:500 ...
-
bioRxiv - Immunology 2021Quote: ... or goat anti-rabbit IgG (250 ng ml−1, 2.5% BSA in PBST; Dako, (Dako, P044801-2) at room temperature for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... or goat anti-rabbit IgG (250 ng ml−1, 2.5% BSA in PBST; Dako, (Dako, P044801-2) at room temperature for 1 h ...
-
bioRxiv - Neuroscience 2023Quote: ... and β-amyloid analysis (pretreatment with formic acid, antibody 4G8, DAKO, M087201-2, 1:100, 30 minutes). Tau pathology was assessed using Braak criteria (Braak et al ...
-
bioRxiv - Bioengineering 2022Quote: ... anti-mouse-IgG conjugated to horseradish peroxidase (1:10,000, cat. no. P016102-2; Dako, Carpinteria, CA, USA), anti-rabbit StarBright 700 (1:2500 ...
-
bioRxiv - Genomics 2019Quote: ... Each pool of RNA was individually labelled with Cyanine-3 and Cyanine-5 (Cy3 and Cy5) using the Low input Quick Amp Labelling Kit (Agilent Technologies) followed by purification through Qiagen RNeasy Columns (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... Retinoid analyses were performed using normal phase Zorbax Sil (5 mm, 4.6 3 150mm) column (Agilent Technologies, Santa Clara, CA, USA). The retinoids were eluted by step-wise gradient starting with 0.5% ethyl acetate in hexane over 15 min ...
-
bioRxiv - Bioengineering 2022Quote: ... Two-channel 54.8 μm z-stack images were taken every 3 hours for 45 hours after co-culture was initiated using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the dre-miR-210-5p as the forward primer: 5’ AGCCACTGACTAACGCACATTG 3’ and the Universal Reverse Primer (N° 600037, Agilent Technologies) as reverse primer.
-
bioRxiv - Bioengineering 2023Quote: ... at 40°C with an InfinityLab Poroshell 2.7 µM EC-C18 pre- column (3 x 5 mm; Agilent Technologies, Waldbronn, Germany) was used ...
-
bioRxiv - Bioengineering 2024Quote: ... two-channel 100 µm z-stack images were taken every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies). Images were processed with NIH Fiji-ImageJ and cell coverage was measured for each cell type at every time point by calculating the area within the well covered by cells and dividing it by the total well area ...
-
bioRxiv - Immunology 2023Quote: ... Rabbit anti-goat IgG (P044901-2) or goat anti-rabbit IgG (P044801-2) secondary antibodies were from Agilent.
-
bioRxiv - Plant Biology 2019Quote: ... 3 x 150-mm Zorbax SB-Aq column (Agilent, Santa Clara, CA). A coupled DAD-3000RS diode array detector (Dionex) ...
-
bioRxiv - Cell Biology 2022Quote: ... grown cells were blocked with 1x PBS containing 3% goat serum (DAKO) for 30 min at RT ...
-
bioRxiv - Microbiology 2021Quote: ... followed by the red 3-amino-9-ethylcarbazole (AEC) HRP substrate (Dako) and counterstaining with haematoxylin ...
-
bioRxiv - Cancer Biology 2023Quote: ... for cleaved Caspase-3 and HRP labeled polymer and DAB chromagen (Dako) for PCNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... Staining was performed following the epitope retrieval process using VectaStain Kit from Vector Labs for cleaved Caspase-3 and horseradish peroxidase-labeled polymer from Dako (K4001) for PCNA ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA expression was measured using SYBR green on a QuantStudio 3 (Agilent). Probes were generated using NCBI primer blast and are listed in Table X ...
-
bioRxiv - Biochemistry 2023Quote: ... The free HSF2BP protein was analyzed using a BIOSEC 3 column (Agilent) equilibrated in 25 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cell Biology 2019Quote: ... and treated with 2% proteinase K (Dako) in Tris-HCl buffer solution (pH 7.5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 2 mM glutamine (Seahorse®, Agilent) in a CO2 free incubator for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... Bluing buffer (Agilent Technologies; Cat # CS703230-2) was then added to the slide until the sections were completely covered and incubated for 2 minutes at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... rabbit polyclonal anti-tau (Agilent, A002401-2) at a 1:3000 dilution ...
-
bioRxiv - Cancer Biology 2020Quote: ... 3E: Rabbit anti-GFAP (DAKO, Z033401-2); Fig ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 mM glutamine (Agilent Technologies, 103579-100), and 10 mM glucose (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli SURE 2 Supercompetent cells (Stratagene, USA) for clonal selection and amplification ...
-
bioRxiv - Neuroscience 2019Quote: ... (2) testing the insert size (Agilent 2100); (10 ...
-
bioRxiv - Genomics 2020Quote: ... and FISH Wash Buffer 2 (Agilent, G9402A) at room temperature for 1 min ...
-
bioRxiv - Molecular Biology 2020Quote: The yeast strain YRG-2 (Stratagene, USA) containing the HIS3 and lacZ reporter genes was used to test transcriptional activation activity ...
-
bioRxiv - Physiology 2021Quote: ... with hematoxylin counter stain (Agilent, S330130-2) was used to visualize positive stain ...
-
bioRxiv - Cell Biology 2020Quote: ... Guinea Pig anti-Insulin (Dako IR00261-2) and mouse anti-TAF4 (TAF II p135 ...
-
bioRxiv - Genomics 2021Quote: ... and bluing buffer (Dako, cat.no.: CS70230-2) followed by Eosin (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-mouse HRP secondary (DAKO K400111-2), OPAL TSA 520 (Akoya # FP1487001KT) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2 mM glutamine (Agilent, 103579-100), and 10 μM HLM006474 or DMSO (vehicle ...
-
bioRxiv - Neuroscience 2022Quote: ... in antibody diluent (Dako, Cat# S080983-2). Sections were rinsed with PBS (3x 5 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... Additional protein block from Dako (X090930-2) was applied ...
-
bioRxiv - Physiology 2022Quote: ... in antibody diluent (Agilent, cat#S080983-2) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2) the pBluescript II SK (-) vector (Agilent) following EcoRV digestion ...
-
bioRxiv - Cell Biology 2019Quote: ... The anc-1 3’UTR RNAi construct was generated by PCR amplifying part of the 3’UTR-region of the anc-1 transcript using Paq5000™ DNA Polymerase (Agilent Technologies, 600682). The primer sequences are detailed in Table S2 ...
-
bioRxiv - Biochemistry 2022Quote: ... All libraries at this step yielded >300,000 colonies implying a 100x coverage (assuming 1/3 of the variants were perfect based on our previous analysis of Agilent OLS based libraries). Each sublibrary was combined at an equimolar ratio to make a complete library with all intended mutations included.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Primary antibodies were diluted 1:4000 for anti-sGCα1 and 1:2000 for anti-sGCβ1 antibody in 3% dry milk in TBST and incubated with nitrocellulose membranes at 4°C over-night following challenge of membranes with secondary goat anti-rabbit antibody (1:2000 in 3% milk in TBST) conjugated to horseradish peroxidase (Dako A/S, Denmark). Immuno-complexes were visualized using an enhanced chemiluminescence kit (Amersham Pharmacia Biotech ...
-
bioRxiv - Biochemistry 2022Quote: 50 μL of pure CrRPE1 concentrated at 9.5 mg mL−1 were injected on BioSEC-3 300 size-exclusion chromatography column (Agilent Technologies, Santa Clara, USA) equilibrated in buffer 20 mM Tris-HCl (pH 7.9 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the slices were incubated with primary antibodies: rabbit polyclonal anti-PSMA/GCPII (1:150) (M362029-2; DAKO, US), anti-CD68 (1:250 ...
-
bioRxiv - Genomics 2020Quote: ... 1 - 2 ng / µl was examined using a 2100 Bioanalyzer and a corresponding High Sensitivity DNA Kit (Agilent) to determine the MW profile of the size-selected library ...
-
bioRxiv - Immunology 2024Quote: ... sections were stained with monoclonal mouse anti-human CD68 clone PG-M1 - 1:100 (Dako Omnis: GA61361-2). Second antigen retrieval and blocking were performed as described above and subsequent staining was performed with either rabbit anti-Gas6 - 1:100 (PA5-79300 ...