Labshake search
Citations for Agilent :
1 - 50 of 3885 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Online mass calibration was performed using a second spray needle and a constant flow (5 ul/min) of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). Compounds were identified based on the retention time of chemical standards and their accurate mass (tolerance 20 ppm) ...
-
bioRxiv - Microbiology 2021Quote: ... Online mass calibration was performed using a second spray needle and a constant flow (5 ul/min) of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). Compounds were identified based on the retention time of chemical standards and their accurate mass (tolerance 20 ppm) ...
-
bioRxiv - Molecular Biology 2023Quote: ... incubated 1h with HRP-conjugated secondary antibodies (DAKO, 1:2000) in 1X TBS-Tween containing 5% non-fat dry milk ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were blocked for with 5% BSA for 1h prior to immunofluorescence staining performed as in (Clément et al., 2018) with PCNA antibody (DAKO, M879, 1:1000). We detected EdU using the Click-iT EdU Cell Proliferation kit as described in (Gatto et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... and rabbit anti-Lysozyme antibody (A0099, DAKO 1:1000 (Fig. 1h), GTX72913 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were incubated for 2h with primary antibody diluted in Blocking Buffer with 5% Goat Serum (Dako #X090710) (antibodies are dilutions used are listed in Table 2) ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent ...
-
bioRxiv - Molecular Biology 2020Quote: ... (Agilent Technologies, Wilmington, DE) equipped with an autosampler ...
-
bioRxiv - Cell Biology 2021Quote: ... (Agilent Technologies, Wilmington, DE) equipped with an autosampler ...
-
bioRxiv - Molecular Biology 2020Quote: ... (Agilent Technologies, Wilmington, DE) equipped with an autosampler ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5 ...
-
bioRxiv - Biochemistry 2021Quote: ... coli BL21 DES cells (Agilent). Cells were grown in Luria Broth in the presence of the selective antibiotic at 37 °C to an OD600 of ∼0.8 ...
-
bioRxiv - Immunology 2023Quote: ... GC (Agilent 6890, Wilmington, DE) separation was performed using a ZB-Wax plus column ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Microbiology 2022Quote: ... Online mass axis correction was performed with purine and hexakis(1H,1H,3H-tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). The source gas temperature of the ESI ion source was 225 °C ...
-
bioRxiv - Immunology 2024Quote: ... and blocked for 1h at room temperature (Dako Protein block ...
-
bioRxiv - Biochemistry 2024Quote: ... 13C NMR spectrum was recorded on a Varian 500 MHz spectrometer equipped with a 5 mm 1H{13C} XSens cold probe (Varian Inc., Palo Alto, CA, USA, now Agilent Technologies). NMR spectra were referenced to the solvent signals (CHD2OD ...
-
bioRxiv - Microbiology 2021Quote: ... Online mass calibration was performed using a second spray needle and a constant flow of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). After processing of raw data as previously described24 ...
-
bioRxiv - Biochemistry 2024Quote: ... 120-73-0) and 2.5 mmol/L hexakis(1H, 1H, 3H-tetrafluoropropoxy)phosphazine (HP-0921, CAS No. 58943-98-9) (Agilent, Cheadle, UK).
-
bioRxiv - Immunology 2024Quote: ... Greyhound Chemicals), 10% LC-MS grade water (Ultra CHROMASOLV, Honeywell Riedel-de Haën) with 5 uM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Genomics 2020Quote: ... After incubation with HRP-conjugated secondary antibodies (1:5000, DAKO p0260 and p0217, 1h at RT), bands or dots were imaged on a chemiluminescence detection system (Bio-rad).
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
Bat influenza vectored NS1-truncated live vaccine protects pigs against heterologous virus challengebioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP)-conjugated polyclonal rabbit anti-mouse immunoglobulins (diluted 1:1000, room temperature, 1h reaction, Dako) were used as the secondary antibody.
-
bioRxiv - Microbiology 2021Quote: ... The extracts were acidified to pH 2 and additionally pre-treated with solid-phase extractions using Agilent Bond Elut-PPL 3 mL columns and diluted to 50 ppm (Agilent Technologies, DE, USA) following standard lab protocol29 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 2.7 μm column (Agilent Technologies, Wilmington, DE, USA) using a gradient of 0 to 95% B in 5 min (A= water with 0.025% TFA and B= 95% acetonitrile in water with 0.025% TFA ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2.7 µm column (Agilent Technologies, Wilmington, DE, USA) set at 35°C ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Biochemistry 2024Quote: ... The TIMS cell pressure was decreased by adjusting the nitrogen flow until the calibration mass 1221 m/z (Hexakis(1H, 1H, 4H-hexafluorobutyloxy)phosphazine (Agilent Technologies, Santa Clara, USA)) ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were digested by DpnI enzyme for 2h at 37°C (Agilent) and loaded on a 1% Agarose Gel ...
-
bioRxiv - Systems Biology 2021Quote: ... and fragment sizes were determined by Agilent bioanalyzer High Sensitivity DNA LabChip (Agilent Technologies, Wilmington, DE) followed by dilution to 10 nM ...
-
bioRxiv - Systems Biology 2021Quote: ... and fragment sizes were determined by Agilent bioanalyzer High Sensitivity DNA LabChip (Agilent Technologies, Wilmington, DE). Amplicons were spiked with a PhiX control library to 20% and mixtures were then sequenced on an Illumina MiSeq V2 (250nt from each end) ...
-
bioRxiv - Cell Biology 2024Quote: ... at 1:500 and 3-3’-diamino-benzidine-tetrahydrochloride (Dako, K3468). Stained sections were imaged using an NanoZoomer 2.0HT (Hamamatsu).
-
bioRxiv - Neuroscience 2022Quote: ... sections were blocked for 1h with serum-free block (Dako, X0909), and incubated over-night with our custom-made DDX5 antibodies (1:500 ...
-
bioRxiv - Biochemistry 2020Quote: ... Complete imidazolinone conversion was checked by 1H-NMR (MR400 MHz, Agilent) For the reversal tests ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: ... using the Agilent XFe96 Seahorse analyzer (Agilent Technologies, Wilmington, DE). HCT116 cells (0.75 x 104 ...
-
bioRxiv - Microbiology 2024Quote: ... validated using an Agilent 2100 Bioanalyzer (Agilent, Wilmington, DE, USA), and quantified with a Qubit 2.0 Fluorometer (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were rinsed and incubated with biotinylated rabbit anti-rat IgG for 1h (1:200, DAKO Cytomation A/S, Denmark). Following avidin-biotin-peroxidase complex (Vector laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biochemistry 2023Quote: ... blots were incubated for 1h at room temperature with a horse radish peroxidase-labeled secondary antibody (anti-rabbit, Dako; 1/1000), and revealed by ECL chemiluminescence (Millipore ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Genomics 2023Quote: ... NanoDrop spectrophotometer (NanoDrop Technologies, Inc., Wilmington, DE) and Fragment Analyzer (Agilent) to assess DNA quality and quantity.
-
bioRxiv - Genomics 2024Quote: ... tissue sections were de-paraffinised and stained in Mayer’s haematoxylin (Dako) for 5 minutes and eosin (Sigma ...
-
bioRxiv - Physiology 2022Quote: ... [U-13C]-palmitate enrichment and [1,1,2,3,3-2H]-glycerol enrichment were measured by GC-MS/MS (Agilent GC model 7890A and Waters Quattro Micro) ...
-
bioRxiv - Bioengineering 2024Quote: ... The resulting polymers were characterized by 1H NMR in CDCl3 and SEC (Agilent Infinity 1200 HPLC ...
-
bioRxiv - Synthetic Biology 2023Quote: ... NMR spectroscopic data (1H, 13C, HSQC, COSY, and HMBC) were collected by Agilent 600 MHz (14.1 Tesla ...
-
bioRxiv - Immunology 2024Quote: ... and blocked for 1h at room temperature (Dako Protein block, Agilent Technologies, USA). Samples were incubated overnight at 4°C in anti-insulin antibody (1:500 Dako ...
-
bioRxiv - Biophysics 2021Quote: ... Using the QuikChange II XL Site-Directed Mutagenesis kit (Agilent, Wilmington, DE), we generated the phosphomimetic Y18E of this tau construct ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA quality was determined on the BioAnalyzer 2100 (Agilent Technologies, Wilmington, DE). RNA sequencing libraries were created using the NEBNext Ultra II Directional RNA-Seq library kit (NEB ...