Labshake search
Citations for Agilent :
1 - 50 of 4817 citations for 5 Iodo 1 Triisopropylsilanyl 1H Pyrrolo 2 3 B Pyridine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Online mass calibration was performed using a second spray needle and a constant flow (5 ul/min) of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). Compounds were identified based on the retention time of chemical standards and their accurate mass (tolerance 20 ppm) ...
-
bioRxiv - Microbiology 2021Quote: ... Online mass calibration was performed using a second spray needle and a constant flow (5 ul/min) of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). Compounds were identified based on the retention time of chemical standards and their accurate mass (tolerance 20 ppm) ...
-
bioRxiv - Molecular Biology 2023Quote: ... incubated 1h with HRP-conjugated secondary antibodies (DAKO, 1:2000) in 1X TBS-Tween containing 5% non-fat dry milk ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were blocked for with 5% BSA for 1h prior to immunofluorescence staining performed as in (Clément et al., 2018) with PCNA antibody (DAKO, M879, 1:1000). We detected EdU using the Click-iT EdU Cell Proliferation kit as described in (Gatto et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... and rabbit anti-Lysozyme antibody (A0099, DAKO 1:1000 (Fig. 1h), GTX72913 ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase B consisted of acetonitrile:water 9:1 with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Biochemistry 2022Quote: ... Sample from each PNT3 variant at 5 mg mL-1 in buffer B containing 6M GDN was injected onto an AdvanceBio SEC 2.7 µm (Agilent) SEC column ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Microbiology 2022Quote: ... Online mass axis correction was performed with purine and hexakis(1H,1H,3H-tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). The source gas temperature of the ESI ion source was 225 °C ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Cancer Biology 2024Quote: ... flowing 2 mM NH4CHO2 (Solvent A) and ACN (Solvent B) at 15 µL/min through a Zorbax SB-C18 column (Agilent, 0.5 x 150 mm, 3 µm). Quantitation was done monitoring MS/MS transitions m/z 242.1 [M + H]+ → m/z 126.1 [M – deoxyribose + H]+ for 5mC ...
-
bioRxiv - Molecular Biology 2020Quote: Per2AS variant 2 overexpression plasmid was generated from 5’RACE and 3’RACE products that were cloned in to pBluescript (Agilent), as well as Per2AS qPCR product cloned into pGEM-T (Promega) ...
-
bioRxiv - Immunology 2020Quote: ... anti-granzyme B (GrB-7; 1:50; Dako) and anti-PanCK (AE1/AE3 ...
-
bioRxiv - Immunology 2024Quote: ... and blocked for 1h at room temperature (Dako Protein block ...
-
bioRxiv - Biochemistry 2024Quote: ... 13C NMR spectrum was recorded on a Varian 500 MHz spectrometer equipped with a 5 mm 1H{13C} XSens cold probe (Varian Inc., Palo Alto, CA, USA, now Agilent Technologies). NMR spectra were referenced to the solvent signals (CHD2OD ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Microbiology 2021Quote: ... Online mass calibration was performed using a second spray needle and a constant flow of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). After processing of raw data as previously described24 ...
-
bioRxiv - Biochemistry 2024Quote: ... 120-73-0) and 2.5 mmol/L hexakis(1H, 1H, 3H-tetrafluoropropoxy)phosphazine (HP-0921, CAS No. 58943-98-9) (Agilent, Cheadle, UK).
-
bioRxiv - Genomics 2020Quote: ... After incubation with HRP-conjugated secondary antibodies (1:5000, DAKO p0260 and p0217, 1h at RT), bands or dots were imaged on a chemiluminescence detection system (Bio-rad).
-
bioRxiv - Cancer Biology 2023Quote: ... anti-CA125 epitope group B (Agilent, M11, 1:100), or anti-CA125 epitope group B (Fitzgerald ...
-
bioRxiv - Plant Biology 2021Quote: ... Dried metabolites were methoximated (20 mg/mL methoxyamine in pyridine) and trimethylsilylated (MSTFA: TMSCI, 99:1) and then analyzed by GC-MS (Agilent 5975, GC/single quadrupole MS). GC-MS data were processed by Agilent MSD ChemStation ...
-
bioRxiv - Biochemistry 2020Quote: ... were separated by a gradient elution from 5% solvent B to 95% solvent B over 15 min on a high-capacity nano-LC chip (Agilent Technologies; part no. G4240-62010) driven by a 1200 series nano-flow HPLC system (Agilent ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-mouse IgG (1.3 μg ml−1, 5% milk in PBST; Dako, P026002-2) or goat anti-rabbit IgG (250 ng ml−1 ...
-
Bat influenza vectored NS1-truncated live vaccine protects pigs against heterologous virus challengebioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP)-conjugated polyclonal rabbit anti-mouse immunoglobulins (diluted 1:1000, room temperature, 1h reaction, Dako) were used as the secondary antibody.
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Bioengineering 2024Quote: ... B: ACN with 0.1% TFA) on a Zorbax C18-300SB 5 μm 9.4x250mm column (Agilent), and analyzed via LC/MS-TOF on an Agilent G6230B ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Biochemistry 2024Quote: ... The TIMS cell pressure was decreased by adjusting the nitrogen flow until the calibration mass 1221 m/z (Hexakis(1H, 1H, 4H-hexafluorobutyloxy)phosphazine (Agilent Technologies, Santa Clara, USA)) ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... at 1:500 and 3-3’-diamino-benzidine-tetrahydrochloride (Dako, K3468). Stained sections were imaged using an NanoZoomer 2.0HT (Hamamatsu).
-
bioRxiv - Neuroscience 2022Quote: ... sections were blocked for 1h with serum-free block (Dako, X0909), and incubated over-night with our custom-made DDX5 antibodies (1:500 ...
-
bioRxiv - Biochemistry 2020Quote: ... Complete imidazolinone conversion was checked by 1H-NMR (MR400 MHz, Agilent) For the reversal tests ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were rinsed and incubated with biotinylated rabbit anti-rat IgG for 1h (1:200, DAKO Cytomation A/S, Denmark). Following avidin-biotin-peroxidase complex (Vector laboratories ...
-
bioRxiv - Immunology 2024Quote: ... and equal numbers of B cells (2 × 105) were plated on extracellular flux assay plates (Agilent Technologies) coated with 2.5 µg/mL CellTak (Corning ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... and B lymphocytes (anti-CD20 mouse IgG2a, 1:150, clone L26, Dako). Tumor epithelial cells were detected using anti-pan-cytokeratin Alexa 488-conjugated mouse IgG1 (1:100 ...
-
bioRxiv - Neuroscience 2024Quote: ... 2) anti-fibrinogen (1/500) (Dako, A008002-2), 3 ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Biochemistry 2023Quote: ... blots were incubated for 1h at room temperature with a horse radish peroxidase-labeled secondary antibody (anti-rabbit, Dako; 1/1000), and revealed by ECL chemiluminescence (Millipore ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Bioengineering 2024Quote: ... The resulting polymers were characterized by 1H NMR in CDCl3 and SEC (Agilent Infinity 1200 HPLC ...
-
bioRxiv - Synthetic Biology 2023Quote: ... NMR spectroscopic data (1H, 13C, HSQC, COSY, and HMBC) were collected by Agilent 600 MHz (14.1 Tesla ...
-
bioRxiv - Immunology 2024Quote: ... and blocked for 1h at room temperature (Dako Protein block, Agilent Technologies, USA). Samples were incubated overnight at 4°C in anti-insulin antibody (1:500 Dako ...
-
bioRxiv - Cell Biology 2021Quote: ... sections were incubated for 2 hours at room temperature with polyclonal guinea pig anti-insulin antibody (1:5, Agilent Technologies). Slides were then washed 3 x 5 minutes with PBS and incubated with the Anti-guinea pig IgG Alexa Fluor 488 (1:200 ...
-
bioRxiv - Developmental Biology 2023Quote: ... with a KpnI site inserted at the 5’ end of Δ3-1 or Δ3-2 (Quick Change Site-Directed Mutagenesis from Stratagene) using the oligonucleotides Δ3-1-KpnI Fw ...
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Plant Biology 2021Quote: ... and 2% Buffer B (0.1% formic acid in Optima grade acetonitrile (Fisher)) using a 1200 series capillary pump (Agilent). Following loading ...