Labshake search
Citations for Agilent :
1 - 50 of 827 citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... anti-alpha-SMA (Dako), anti-fibronectin (AbCam ...
-
bioRxiv - Cancer Biology 2022Quote: ... Estrogen Receptor alpha (ERα, Clone EP1, Dako IR 084), GATA3 (sc-268 ...
-
bioRxiv - Bioengineering 2020Quote: ... or anti-alpha Fetoprotein (AFP) (DAKO, Cat. # A0008; 1:300). Cardiomyocytes were immunostained with anti-α-Actinin (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... monoclonal mouse anti-human alpha smooth muscle actin (M0851, Dako), monoclonal mouse anti-human CD68 (M0814 ...
-
bioRxiv - Cancer Biology 2021Quote: ... estrogen receptor alpha (ERα) (clone:EP1, DAKO IR 084, ready-to-use), FOXA1 (Santa Cruz Biotechnology sc-6553 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-smooth muscle alpha-actin (α-SMA - Dako GA611, 1:100), anti-ACE2 (Merck SAB3500346 ...
-
bioRxiv - Genomics 2024Quote: ... HLA-DR alpha-chain clone TAL.1B5 dilution 1:200 (M0746, Dako), CD68 clone PG-M1 dilution 1:100 (M0876 ...
-
bioRxiv - Physiology 2021Quote: ... sections were immunostained with alpha-smooth muscle actin (α-SMA) antibody (Clone 1A4, DAKO, M0851 ...
-
bioRxiv - Microbiology 2023Quote: ... RNA integrity number (RIN) was >8 for all samples (Agilent 1200 bioanalyzer, Alpha Metrix Biotech). Labeling of total RNA (100 ng ...
-
bioRxiv - Biochemistry 2022Quote: ... which was labelled with alpha-32P-ATP using the Prime-It II Random Primer Labelling Kit (Agilent) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: PFDN5 ORF (splice variant alpha) was cloned EcoRI/SalI into pCMV-Tag 2A (N- terminal Flag tag, Agilent) or XhoI/EcoRI into pEGFP-C1 (N-terminal GFP tag ...
-
bioRxiv - Physiology 2024Quote: ... Proline point mutations were made in the Nav1.5 alpha subunit with the QuikChange II site-directed mutagenesis kit (Agilent) and primers from Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein immunodetection was performed with primary abs diluted in blocking solution during overnight incubation at 4°C: rabbit polyclonal ab against alpha-1-antitrypsin (A0012, Dako, Agilent) at a 1:500 dilution ...
-
bioRxiv - Cell Biology 2021Quote: ... fixed paraffin-embedded and analysis of alpha and beta cell proliferation was performed in sections immunolabeled with anti-insulin (A5064, Agilent, Santa Clara ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein immunodetection was performed with primary abs diluted in blocking solution during overnight incubation at 4°C: rabbit polyclonal ab against alpha-1-antitrypsin (A0012, Dako, Agilent) at a 1:500 dilution ...
-
bioRxiv - Physiology 2021Quote: ... sections were immunostained with alpha-smooth muscle actin (α-SMA) antibody (Clone 1A4, DAKO, M0851, Agilent Technologies, Santa Clara, CA, USA). Slides containing gastrocnemius muscle sections were deparaffinized in xylene and rehydrated using a graded ethanol series ...
-
bioRxiv - Pathology 2024Quote: ... Van-Gieson as a specific elastin stain or labelled with alpha-smooth muscle actin (a-SMA, Cat#M0851, Dako, 1:1000) as a specific marker for muscle ...
-
bioRxiv - Pathology 2022Quote: ... and a monoclonal antibody directed against the alpha isoform of smooth muscle actin at a working dilution of 1/100 (a-SMA, clone 1A4, n M0851; Dako, Denmark A/S). Alligator skeletal muscle was used as positive control for anti-desmin antibody (Supplemental figure 3A) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 µm (Agilent). Next ...
-
bioRxiv - Pathology 2023Quote: ... Sections from the first level (main experiment) were stained for smooth muscle alpha-2 actin (ACTA2) and galectin 3 (LGALS3) using mouse monoclonal anti-ACTA2 (Dako, cat. no. M0851, 1:100) after blocking with Fab fragment (Jackson ImmunoResearch ...
-
bioRxiv - Cell Biology 2024Quote: ... 5[μm column (Agilent).The mobile phases were MS solvent A (H2O ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5% goat serum (Dako) for 1h ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl C18 Cartridges (Agilent) were used as solid phase ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µl C18 cartridges (Agilent) were primed with 80% acetonitrile (ACN ...
-
bioRxiv - Plant Biology 2021Quote: ... Peptides were first loaded onto a C18 trap column (5 µm, 5 × 0.3 mm, Agilent Technologies) and then eluted into a C18 analytical column (75 μm × 150 mm ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μm particle size (Agilent Technologies) was employed for metabolite separation with a linear gradient of 95:5 A/B to 30:70 A/B over 5 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5% mouse serum (Agilent, Germany). Positive cells were isolated with the micromanipulator and subjected to whole genome amplification.
-
bioRxiv - Cell Biology 2020Quote: ... blocked in 5% donkey serum (Dako) in PBS and incubated with primary antibody (α-TFAM (Mouse ...
-
bioRxiv - Bioengineering 2024Quote: ... BioTek Cytation 5 Cell Imager (Agilent) was used to take RFP ...
-
bioRxiv - Cancer Biology 2024Quote: ... with Gen 5 imaging software (Agilent) taken at 4x.
-
bioRxiv - Cancer Biology 2024Quote: ... with Gen 5 imaging software (Agilent) taken at 4X ...
-
bioRxiv - Molecular Biology 2024Quote: ... HP-5 MS column (5% phenyl methyl polysiloxane: 30m x 0.25mm i.d. x 0.25 µm, Agilent technologies) was used for metabolite separation ...
-
bioRxiv - Biochemistry 2023Quote: ... using a C8 reverse phase micro-column (Zorbax 300SB-C8, 5 µm, 5 × 0.3 mm, Agilent Technologies). The sample was then eluted with 70% of mobile phase B (flow rate of 50 µl/ min ...
-
bioRxiv - Immunology 2023Quote: ... Images were acquired (1-5 images per subject) using the Cytation 5 Cell Imaging MultiMode Reader (Agilent). Images were processed to quantify fluorescence intensity using Gen5 software package 3.08.
-
bioRxiv - Biochemistry 2024Quote: ... Pulsed-splitless injection was used to apply 5 μL samples to a HP-5 ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies; 30 m X 250 μm X 0.25 μm) at an inlet temperature of 220°C and a transfer temperature of 240°C ...
-
bioRxiv - Cell Biology 2020Quote: ... at 5 ng/μl and pBSKS (Stratagene) at 70 ng/μl for a total of 100 ng/μl ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5 minutes with Liquid DAB (Dako). Samples were counterstained with hematoxilin.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 5 µm (Agilent Technologies, Santa Clara, CA). The following HPLC conditions were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μm (Agilent Technologies, Santa Clara, USA) was used for peptide separation ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μm (Agilent Technologies, Santa Clara, USA) constituted the stationary phase ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl Fe(III)-NTA cartridges (Agilent) were primed with 100 μL of 0.1% TFA in H2O and equilibrated with 50 μl 0.1% TFA in 80% ACN [37] ...
-
bioRxiv - Cell Biology 2023Quote: ... and Rabbit Anti-Mouse (Dako P044701-5) secondary antibodies were purchased from Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: ... C18 cartridges (Agilent, 5 µL bed volume) were primed with 100 µL 90% acetonitrile (ACN ...
-
bioRxiv - Neuroscience 2024Quote: ... High pH kit reagents (K800021-5, Dako). pSer202/Thr205-tau antibody (MN1020B ...
-
bioRxiv - Systems Biology 2024Quote: ... Fe(III)-NTA cartridges (Agilent, 5 µL) were initially primed with 100 µL of 50% MeCN/0.1%TFA and equilibrated with 50 µL of 80% MeCN/0.1% TFA ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mM HEPES (Agilent, Cat. # 103337-100 ). Cells were plated in Seahorse 96 well plates (Agilent ...
-
bioRxiv - Cancer Biology 2024Quote: ... were separated by injecting 5 μL sample on a ZORBAX SB-C18 column (2.1*50 mm, 5 µm, Agilent). The mobile phase was as follows ...
-
bioRxiv - Systems Biology 2020Quote: ... lyophilized samples were resuspended in Buffer A (5 mM NH4HCO2/ 2% ACN) and 5 mg peptide material (5 mg/ml) was loaded onto a reversed phase column (ZORBAX 300Extend-C18, Agilent). Peptides were separate at a flow rate of 2 ml/min and a constant column temperature of 40 °C using a binary buffer system ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 Pulsed-splitless injection was used to inject 5 μL samples onto an HP-5ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...