Labshake search
Citations for Agilent :
1 - 50 of 2232 citations for 4 5 5 5 Tetrafluoro 4 trifluoromethoxy pentan 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Bioengineering 2022Quote: ... Cell nuclei were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) for 5 min before being mounted using DAKO mounting medium (Agilent, catalog no. S302380–2). Imaging of the histological samples was performed on the Microscope Axio Imager.A2 (Carl Zeiss Microscopy ...
-
bioRxiv - Cancer Biology 2024Quote: ... the AFC (7-amino-4-trifluoromethyl coumarin) fluorescent signals were measured on a Cytation 5 instrument (Agilent Technologies) using the fluorometer function (410-20nm excitation bandwidth ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 µm (Agilent). Next ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 1 μM (OMM2.3) carbonyl cyanide 4-(trifluoromethoxy)-phenylhydrazone (FCCP) and 0.5 μM of a rotenone antimycin A mix (Agilent). Following the assay ...
-
bioRxiv - Immunology 2020Quote: ... FCCP [carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone] (1.5 μM) and Rotenone/Antimycin A (1 μM) (purchased from Agilent Technologies) were injected ...
-
bioRxiv - Cell Biology 2024Quote: ... 5[μm column (Agilent).The mobile phases were MS solvent A (H2O ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5% goat serum (Dako) for 1h ...
-
bioRxiv - Microbiology 2021Quote: ... All other synthetic or expressed peptide substrates were purified and analyzed at small scale utilizing analytical-scale reverse-phase HPLC on an Agilent 1100 series HPLC system (Santa Clara, CA) employing an Eclipse Plus C18 column (5 μm, 4 × 150 mm) (Agilent) at a flow rate of 1 mL/min ...
-
mTOR inhibition enhances delivery and activity of antisense oligonucleotides in uveal melanoma cellsbioRxiv - Cancer Biology 2021Quote: ... or 1 µM (OMM1) carbonyl cyanide 4-(trifluoromethoxy)-phenylhydrazone (FCCP) and 0.5 µM of a rotenone antimycin A mix (Agilent Technologies). Following the assay ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μM of carbonylcyanide-4-(trifluoromethoxy)-phenylhydrazone (FCCP) (Seahorse XF Cell Energy Phenotype Test Kit from Agilent or Sigma Aldrich), and 1 μM of antimycin A and rotenone (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... then stained with DAPI for 10 minutes at room temperature followed by 4 x 5-minutes washes in 1X PBS before being mounted using antifade fluorescence mounting media (Dako, S3023).
-
bioRxiv - Cell Biology 2023Quote: ... bordered (∼ 5 x 2 cm rectangle) with a hydrophobic fat pen (Dako). A glass coverslip ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl C18 Cartridges (Agilent) were used as solid phase ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µl C18 cartridges (Agilent) were primed with 80% acetonitrile (ACN ...
-
bioRxiv - Neuroscience 2020Quote: ... blocked using 10% Normal Goat Serum (NGS) and incubated overnight with the following primary antibodies in 5% NGS overnight at 4°C: rabbit anti-GFAP (DAKO; #Z0334;1:1000), rat anti-L1-CAM (Millipore ...
-
bioRxiv - Genetics 2023Quote: ... Kallisto quant settings were adjusted to -b 5 -l 160 -s 20 - -single - -threads 4 based on fragment lengths determined by the Agilent 4200 TapeStation (Agilent Technologies, Inc.)
-
bioRxiv - Microbiology 2021Quote: ... for 5 minutes at room temperature and Oligo aCGH Wash Buffer 2 (Agilent) for 1 minute at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... and electroporated in 5 separate cuvettes containing 4 µL of the plasmid and 40 µL of ElectroTen-Blue electrocompetent cells (Agilent Santa Clara, CA). After a 1 hour outgrowth in LB at 37C ...
-
bioRxiv - Plant Biology 2021Quote: ... Peptides were first loaded onto a C18 trap column (5 µm, 5 × 0.3 mm, Agilent Technologies) and then eluted into a C18 analytical column (75 μm × 150 mm ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μm particle size (Agilent Technologies) was employed for metabolite separation with a linear gradient of 95:5 A/B to 30:70 A/B over 5 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5% mouse serum (Agilent, Germany). Positive cells were isolated with the micromanipulator and subjected to whole genome amplification.
-
bioRxiv - Cell Biology 2020Quote: ... blocked in 5% donkey serum (Dako) in PBS and incubated with primary antibody (α-TFAM (Mouse ...
-
bioRxiv - Bioengineering 2024Quote: ... BioTek Cytation 5 Cell Imager (Agilent) was used to take RFP ...
-
bioRxiv - Cancer Biology 2024Quote: ... with Gen 5 imaging software (Agilent) taken at 4x.
-
bioRxiv - Cancer Biology 2024Quote: ... with Gen 5 imaging software (Agilent) taken at 4X ...
-
bioRxiv - Molecular Biology 2024Quote: ... HP-5 MS column (5% phenyl methyl polysiloxane: 30m x 0.25mm i.d. x 0.25 µm, Agilent technologies) was used for metabolite separation ...
-
bioRxiv - Immunology 2023Quote: ... Images were acquired (1-5 images per subject) using the Cytation 5 Cell Imaging MultiMode Reader (Agilent). Images were processed to quantify fluorescence intensity using Gen5 software package 3.08.
-
bioRxiv - Biochemistry 2023Quote: ... using a C8 reverse phase micro-column (Zorbax 300SB-C8, 5 µm, 5 × 0.3 mm, Agilent Technologies). The sample was then eluted with 70% of mobile phase B (flow rate of 50 µl/ min ...
-
bioRxiv - Biochemistry 2024Quote: ... Pulsed-splitless injection was used to apply 5 μL samples to a HP-5 ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies; 30 m X 250 μm X 0.25 μm) at an inlet temperature of 220°C and a transfer temperature of 240°C ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-mouse IgG (1.3 μg ml−1, 5% milk in PBST; Dako, P026002-2) or goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Cell Biology 2020Quote: ... at 5 ng/μl and pBSKS (Stratagene) at 70 ng/μl for a total of 100 ng/μl ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5 minutes with Liquid DAB (Dako). Samples were counterstained with hematoxilin.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 5 µm (Agilent Technologies, Santa Clara, CA). The following HPLC conditions were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μm (Agilent Technologies, Santa Clara, USA) was used for peptide separation ...
-
bioRxiv - Bioengineering 2022Quote: ... 5 μm (Agilent Technologies, Santa Clara, USA) constituted the stationary phase ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 μl Fe(III)-NTA cartridges (Agilent) were primed with 100 μL of 0.1% TFA in H2O and equilibrated with 50 μl 0.1% TFA in 80% ACN [37] ...
-
bioRxiv - Cell Biology 2023Quote: ... and Rabbit Anti-Mouse (Dako P044701-5) secondary antibodies were purchased from Agilent ...
-
bioRxiv - Cancer Biology 2023Quote: ... C18 cartridges (Agilent, 5 µL bed volume) were primed with 100 µL 90% acetonitrile (ACN ...
-
bioRxiv - Neuroscience 2024Quote: ... High pH kit reagents (K800021-5, Dako). pSer202/Thr205-tau antibody (MN1020B ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mM HEPES (Agilent, Cat. # 103337-100 ). Cells were plated in Seahorse 96 well plates (Agilent ...
-
bioRxiv - Systems Biology 2024Quote: ... Fe(III)-NTA cartridges (Agilent, 5 µL) were initially primed with 100 µL of 50% MeCN/0.1%TFA and equilibrated with 50 µL of 80% MeCN/0.1% TFA ...
-
bioRxiv - Cancer Biology 2024Quote: ... were separated by injecting 5 μL sample on a ZORBAX SB-C18 column (2.1*50 mm, 5 µm, Agilent). The mobile phase was as follows ...
-
bioRxiv - Systems Biology 2020Quote: ... lyophilized samples were resuspended in Buffer A (5 mM NH4HCO2/ 2% ACN) and 5 mg peptide material (5 mg/ml) was loaded onto a reversed phase column (ZORBAX 300Extend-C18, Agilent). Peptides were separate at a flow rate of 2 ml/min and a constant column temperature of 40 °C using a binary buffer system ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 Pulsed-splitless injection was used to inject 5 μL samples onto an HP-5ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies ...
-
bioRxiv - Biochemistry 2022Quote: ... SEC profiles for the KWOCAS (Figures 2,3,5 and Supplementary Figure S7) were obtained by high pressure liquid chromatography on an Agilent Bio SEC-5 column (Agilent) at a flow rate of 0.35 mL/min by injection of 10 μL of purified eluate using a mobile phase of Tris-buffered saline (50 mM Tris pH 8 ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Plant Biology 2024Quote: ... A splitless injection volume of 1 μL was injected onto an HP-5 column with 5% phenyl methylpolysiloxane stationary phase (Agilent) with dimensions of 30 m x 0.25 mm x 0.25 μm ...