Labshake search
Citations for Agilent :
1 - 50 of 1456 citations for 3 hydroxy 20 oxopregn 5 en 21 yl acetate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... blocked with 5% skimmed milk and probed successively with anti-Flag (Agilent, 200474-21) and anti-Rat (Licor ...
-
bioRxiv - Biochemistry 2024Quote: ... aortas were mounted en face with Dako fluorescence mounting medium (Agilent). Samples were examined using laser scanning confocal microscopy as described in the ‘Microscopy’ section.
-
bioRxiv - Microbiology 2023Quote: BL-21 Rosetta cells (Stratagene) were transformed with the resulting plasmids and cultured to an optical density (OD ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase A consisted of water with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 x volume of 3M Acetate (pH 5.5) and 3 x volume of 100% ethanol.Library sizes were measured on 2100 Bioanalyzer instrument (Agilent) using the Agilent High Sensitivity DNA kit (Agilent ...
-
bioRxiv - Plant Biology 2020Quote: ... Mega BE-C18 (5 g, 20 ml; Agilent), was conditioned with 100 ml of 100% methanol and equilibrated with 50 ml of deionized water ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Cell Biology 2020Quote: ... BL-21(DE3) competent cells (Agilent) were transformed with the plasmid following supplier protocol and plated on LB agar plated with ampicillin selection overnight at 37 °C ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... rat α-DYKDDDDK (#200474-21, Agilent) for FLAG signals ...
-
bioRxiv - Neuroscience 2021Quote: ... coli BL-21 (DE3, Agilent Technologies) was performed as described previously (Goedert and Jakes ...
-
bioRxiv - Cell Biology 2022Quote: ... BL-21(DE3) competent cells (Agilent) were transformed with the plasmids following supplier protocol and plated on LB agar plated with kanamycin selection overnight at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... coli BL-21 DE3 strain (Stratagene) for protein expression and purification purposes ...
-
bioRxiv - Immunology 2023Quote: ... coli BL-21 (RIPL) (Agilent Technologies) cells ...
-
bioRxiv - Neuroscience 2021Quote: ... Mobile phase B consisted of acetonitrile:water 9:1 with 10 mM ammonium acetate + 5 μM medronic acid (Agilent), pH 9 ...
-
bioRxiv - Biochemistry 2020Quote: ... BL-21-CodonPlus(DE3)-RIL cells (Agilent) were used for protein expression ...
-
bioRxiv - Molecular Biology 2020Quote: ... Bisulfite-converted DNA was used for PCR amplification of the DMRs and products were visualized on a 3% Tris-Acetate-EDTA agarose gel and quantified by TapeStation (Agilent).
-
bioRxiv - Cancer Biology 2023Quote: ... used a two solvent gradient (Mobile Phase A: 10 mM Ammonium Acetate in 90/10 Water/Acetonitrile, pH 9.2, 5 μm Agilent InfinityLab Deactivator Additive ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Evolutionary Biology 2020Quote: ... or with minor N-terminal truncations to exclude the transmembrane regions (Sphaeroforma arctica: amino acids 21-316; Auxenochlorella protothecoides: amino acids 21-327) in Arctic Express DE competent cells (Agilent). At the N-terminus ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), rabbit anti-4E-BP1 (1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-FLAG (1:2000, #200473-21, Agilent), mouse anti-V5 (1:1000 ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Biochemistry 2021Quote: ... YpfP was overexpressed in BL-21 Gold (DE3) (Stratagene) cells ...
-
bioRxiv - Immunology 2021Quote: ... cells were treated with 48μL GeneJammer (Agilent 204130-21), 6μg S_IgE_deltaCterm19_plasmid (Genscript) ...
-
bioRxiv - Microbiology 2023Quote: ... The acetate concentration was analysed by HPLC (Agilent 1260 Infinity II ...
-
bioRxiv - Microbiology 2024Quote: ... coli BL-21(DE3) (Stratagene, West Cedar Creek, TX, USA). Both plasmids were maintained in E ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5-20 ng of the pooled PCR product was analyzed using Tapestation (Agilent), and the average molecular weight of the pooled amplicon was calculated ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Cell Biology 2021Quote: ... acetate and glycerol contents were measured simultaneously by Agilent 1100 HPLC system with a Shodex Asahipak SH1011 column ...
-
bioRxiv - Microbiology 2022Quote: ... and 20% glycerol at 30°C in a BioTek Cytation 5 imaging reader (Agilent) with filters for excitation at 360/40 nm and emission at 460/40 nm ...
-
bioRxiv - Microbiology 2021Quote: ... Sections labelled for F4 were incubated with secondary antibody from kit polymer-HRP anti-rabbit (Dako En Vision+ System-HRP, Dako, Glostrup, Denmark) while sections labelled for CD3 were incubated with anti-mouse biotinylated secondary antibody (catalogue number BA-2000-1.5 Vector Laboratories ...
-
bioRxiv - Biochemistry 2023Quote: ... the membranes were incubated with anti-FLAG antibody (Agilent, Cat# 200474-21) or anti β-actin (Cell Signaling ...
-
bioRxiv - Plant Biology 2020Quote: ... were loaded onto 20 cm capillary columns packed with 5 μM Zorbax SB-C18 (Agilent), which was connected using a zero dead volume 1 μm filter (Upchurch ...
-
bioRxiv - Cancer Biology 2020Quote: ... blocked in 0.5% hydrogen peroxide for 5 minutes at room temperature and then blocked with 20% normal rabbit or goat serum (DAKO, Agilent, Cheadle, Cheshire, UK) for 20 min and incubated with the primary antibody overnight at +4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Signal was developed with the Envision+ System/HRP Kit in 5–20 min (K4007, Agilent/Dako).
-
bioRxiv - Cancer Biology 2023Quote: ... Signal was developed with the Envision+ System/HRP Kit in 5–20 min (K4007, Agilent/Dako).
-
bioRxiv - Neuroscience 2021Quote: ... Lipids were resolved on a 3 150 mm XDB-C8 column (5 μM particle size) (Agilent) at flow rate 0.4 mL/min ...
-
bioRxiv - Molecular Biology 2020Quote: ... with a specific primer (5’-CCTACACGACGCTCTTCC-3’) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). Then ...
-
bioRxiv - Cancer Biology 2023Quote: ... The signal was developed with the Envision+ System/HRP Kit in 5–20 min (K4007, Agilent/Dako). Iba1+ cells were quantified based on the ImageJ plugin 46 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The signal was developed with the Envision+ System/HRP Kit in 5–20 min (K4007, Agilent/Dako). Iba1+ cells were quantified based on the ImageJ plugin 46 ...
-
bioRxiv - Cell Biology 2022Quote: ... The expression of the GST-GAP fusion protein in E.coli strain BL-21-RILP (Stratagene) and its purification using Glutathione Sepharose 4B were performed as described previously (Jung et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... 5–20 ms at 1 Hz) controlled by a Picospritzer III (General Valve) and a pulse generator (Agilent). The rate of injection was ∼20 nl/minute ...
-
bioRxiv - Neuroscience 2020Quote: ... 5–20 ms at 0.5 Hz) controlled by a Picrospritzer III (General Valve) and a pulse generator (Agilent). During the surgical procedure ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-20 ms at 1 Hz) controlled by a Picospritzer III (General Valve) and a pulse generator (Agilent). The rate of injection was ~20 nl/min ...
-
bioRxiv - Neuroscience 2020Quote: ... 5–20 ms at 0.5 Hz) controlled by a Picrospritzer III (General Valve) and a pulse generator (Agilent). During the surgical procedure ...
-
bioRxiv - Neuroscience 2023Quote: ... 5–20 ms at 1 Hz) controlled by a Picospritzer III (General Valve) and a pulse generator (Agilent). The speed of injection was ∼0.1 μl/10 min ...
-
bioRxiv - Microbiology 2023Quote: ... both with 10 mM ammonium acetate and 2.5 μM InfinityLab Deactivator Additive (Agilent), pH 9.0 ...
-
bioRxiv - Neuroscience 2021Quote: ... Next day membranes were washed for 3 x 5 min and incubated with HRP-coupled secondary antibodies (DAKO) diluted 1:3000 in washing buffer for 1.5 hour at RT ...