Labshake search
Citations for Agilent :
1 - 50 of 1271 citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The tert-butyldimethylsilyl (TBDMS) derivatized samples were analyzed with a gas chromatograph connected to a mass spectrometer (GC-MS) (Agilent 7890A and 5975C inert XL Mass Selective Detector) ...
-
bioRxiv - Biochemistry 2021Quote: HMECs were cultured at a density of 3 x 104 cells/well in 24-well Seahorse XFe24 plates (Agilent) and incubated at 37 °C under a humidified 5% CO2 atmosphere overnight in the presence or absence of DMF ...
-
bioRxiv - Cell Biology 2023Quote: ... Myotubes grown on 24 well plates were fasted for 3 h in glucose-free DMEM (103575-100, Agilent, USA). Incubation with 100 nM insulin (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2023Quote: ... 800 µL sample and MTBSTFA (100 µL, N-tert-butyldimethylsilyl)-N-methyltrifluoroacetamide) were transferred to amber capped glass vials (Agilent Technologies, USA), heated to 80 °C for 20 min ...
-
bioRxiv - Immunology 2024Quote: ... using a 96-or 24-well extracellular flux analyzer XFe-96 and XFe-24 (Seahorse Bioscience) as previously described [79].
-
bioRxiv - Neuroscience 2022Quote: ... samples were suspended in a 4M urea buffer containing ampholytes and subjected to off-gel IEF fractionation using a 24 well strip (pH 3-10) (Agilent, 3100 Off- gel fractionator). Following IEF ...
-
bioRxiv - Neuroscience 2022Quote: ... the sections were mounted on slides with Dako fluorescent mounting medium (Agilent-a o S3 3). The following primary antibodies were used ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Biochemistry 2022Quote: ... All libraries at this step yielded >300,000 colonies implying a 100x coverage (assuming 1/3 of the variants were perfect based on our previous analysis of Agilent OLS based libraries). Each sublibrary was combined at an equimolar ratio to make a complete library with all intended mutations included.
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Immunology 2024Quote: Cells (5×105 cells/well) were plated after isolation on XFe-24-cell culture plates (Agilent), treated with cmCTR/cmMTB/HF-PE or TB-PE for one ...
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Immunology 2024Quote: ... on an XF-24 Extracellular Flux Analyzers (Seahorse Bioscience).
-
MIIP downregulation promotes colorectal cancer progression via inducing adjacent adipocytes browningbioRxiv - Cancer Biology 2023Quote: The Seahorse Bioscience XF-24 Flux Analyzer (Agilent Technologies) was used to measure the OCR of tumor cells according to the manufacturer’s protocol (Calton et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biochemistry 2023Quote: ... the 24 well cell culture plates (Agilent Technologies 102340-100) were seeded with 18000 cells per well ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Genetics 2021Quote: ... Samples were diluted to 24 uL with TE dilution buffer (Agilent) and loaded into the 5200 Fragment Analyzer System (Agilent ...
-
bioRxiv - Immunology 2020Quote: ... using Lipofectamine 2000 for 24 h (Stratagene, La Jolla, CA, USA). For IL-8 native promoter experiment ...
-
bioRxiv - Neuroscience 2024Quote: ... Whole-miBrain images were collected after 24 hours (Cytation 10, Agilent BioTek ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
bioRxiv - Cell Biology 2024Quote: ... at 1:500 and 3-3’-diamino-benzidine-tetrahydrochloride (Dako, K3468). Stained sections were imaged using an NanoZoomer 2.0HT (Hamamatsu).
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen–antibody complexes were reveled with 3-3′-diaminobenzidine (K346811, Agilent). Sections were counterstained with hematoxylin (CS700 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 of the 24 wells on an islet capture microplate (Agilent Technologies) were used for mutant zebrafish larvae ...
-
bioRxiv - Immunology 2022Quote: ... Plates were analyzed using an XFe 24 Extracellular Flux Analyzer (Agilent Technologies). Glycolysis was calculated as average post-glucose ECAR values minus average basal ECAR values.
-
bioRxiv - Cell Biology 2023Quote: ... Cells were then washed in PBS 5 x 5 mins, then mounted with a cleaned glass coverslip (#1.5, 24 mm x 60 mm) in mounting media (Dako; Pathology Products, S3023).
-
bioRxiv - Microbiology 2021Quote: ... Tissue sections were colored via DAB-staining (3, 3-diaminobenzidine; Dako, K3468).
-
bioRxiv - Synthetic Biology 2020Quote: ... We then ordered the following oligo library (OL) from Agilent: 100k oligos (Extended Data Table 1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-Diaminobenzidine (DAB, Agilent) and then counterstained with haematoxylin (Abcam) ...
-
bioRxiv - Cell Biology 2020Quote: ... a Seahorse XF-24 Analyser or a Seahorse XFe-96e Analyser (Agilent technologies) was used ...
-
bioRxiv - Synthetic Biology 2022Quote: To assemble an oligonucleotide Library Synthesis (OLS) Pool (oligo pool; Agilent) into an AAV genome ...
-
bioRxiv - Genomics 2022Quote: ... we took advantage of an improved HiFi OLS platform from Agilent, which led to reduced error rates such that 80% of our final Kir2.1 variants consist only of our designed mutations.
-
bioRxiv - Cancer Biology 2023Quote: ... in 3 cycles for 3 hours using the Seahorse XFe24 analyzer system (Agilent Technologies). Inhibitors and substrates were used at the following concentrations ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm column (Agilent), column temperature 50 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... at 97°C (24 minutes) or TRS Low pH (Agilent/Dako, Cat. no GV805) at 97°C (20 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... at 97°C (24 minutes) or TRS Low pH (Agilent/Dako, Cat. no GV805) at 97°C (20 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... for 24 h or by 15 µg/ml α-human IgG (Agilent #A042301-2) for 48 h ...
-
bioRxiv - Immunology 2022Quote: OCR was measured using a 24-well XF extracellular flux analyzer (EFA) (Seahorse Bioscience). Isolated hpT and dpT cells (1×106 cells per well ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were diluted to 24 μL in TE dilution buffer (Agilent, DNF-495-0060) and loaded into the 5200 Fragment Analyzer System (Agilent ...
-
bioRxiv - Pathology 2024Quote: ... Mitochondrial OCR was analyzed using the Seahorse XFe 24 Extracellular Flux Analyzer (Seahorse Bioscience), and the results were expressed as pmol/minute as described (54).
-
bioRxiv - Cell Biology 2024Quote: iMuSCs were seeded in XFe 24-well plates (Seahorse Bioscience, North Billerica, MA, USA) at a density of 1 × 10⁴ cells/well ...
-
bioRxiv - Cancer Biology 2024Quote: OCRs and ECARs were quantified using an XFe-24 Extracellular Flux Analyzer (Seahorse Bioscience). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... Lipids were resolved on a 3 150 mm XDB-C8 column (5 μM particle size) (Agilent) at flow rate 0.4 mL/min ...