Labshake search
Citations for Agilent :
1 - 50 of 1657 citations for 3 Bromo 4 8 dichloro 5 methoxyquinoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4×180K or 8×60K SurePrint G3 human CGH microarray (Agilent Technologies) according to manufacturer’s instructions (CGH enzymatic protocol v6.2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Plant Biology 2020Quote: ... 4 μg of total RNA with an RNA Integrity Number (RIN) ≥ 8 (Bioanalyzer 2100, Agilent Technologies ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and by blocking using a 5% Normal Rabbit Serum (NRS) solution (X090210-8, Agilent Technology) for 30 minutes at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Cell Biology 2024Quote: Respirometry of intact cells (n = 5–8 per cell line) was measured with a Seahorse Analyzer (Agilent) following the manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2022Quote: ... A frequency of 59.673 MHz and an amplitude of 8 dBm was generated by a signal generator (EXG Analog Signal Generator, NS171B, 9 kHz – 3 GHz, Agilent) and fed into the transmitter and reception boards of the scanner via a respective custom made power splitter.5
-
bioRxiv - Microbiology 2022Quote: ... 8×15K (Agilent) was customized in order to include different sets of probes as indicated elsewhere (Beites et al. ...
-
bioRxiv - Microbiology 2024Quote: ... Amplicons (each 3-4 kbs in length) were generated via PCR using EasyA polymerase (Agilent) and Sanger sequenced.
-
bioRxiv - Cancer Biology 2021Quote: ... Scanning of microarrays was performed with 3 μm resolution (8×60K) using a G2565CA high-resolution laser microarray scanner (Agilent Technologies). Microarray image data were processed with the Image Analysis/Feature Extraction software G2567AA v ...
-
bioRxiv - Developmental Biology 2024Quote: ... primary cultured chondrocytes were seeded at a density of 3 × 104 cells per well into an 8-well Seahorse culture plate (Seahorse Bioscience). For OCR analysis ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were washed for 5 minutes using 1X Wash Buffer and then blocked by adding 8 drops of Protein Block Serum-Free (Agilent). Primary antibodies were diluted in diluent (Dako ...
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2,000 cells were seeded on a well of a 96-well plate and brightfield images were taken every two hours by using the BioTek BioSpa 8 Automated Incubator and Citation 5 reader (Agilent). BioTek Gen5 imaging software (Agilent ...
-
bioRxiv - Bioengineering 2024Quote: ... 8 U/mL (Prozyme) – 400 U/mL (NEB) ...
-
bioRxiv - Neuroscience 2021Quote: ... Lipids were resolved on a 3 150 mm XDB-C8 column (5 μM particle size) (Agilent) at flow rate 0.4 mL/min ...
-
bioRxiv - Molecular Biology 2020Quote: ... with a specific primer (5’-CCTACACGACGCTCTTCC-3’) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). Then ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2021Quote: ... approximately 8 µg of protein was injected on a Zorbax 300SB-C18 column (5 µm, 300Å, 1×250mm IDxL; Agilent Technologies) and separated using a 30 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 µL of eluted RNA and 5 µL RNA ScreenTape sample buffer was mixed in an 8-well PCR tube strip (Agilent Technologies) via vortexing for one minute (IKA MS3 Vortexer ...
-
bioRxiv - Cell Biology 2024Quote: ... Following the 24 min gradient the analytical column was backflushed for 6 min with 99% acetonitrile at a 0.8 ml/min flow rate followed by a 5 min re-equilibration step (MassHunter Metabolomics dMRM Database and Method, Agilent Technologies). Data analysis was performed with MassHunter Quantitative Analysis (v ...
-
bioRxiv - Cancer Biology 2021Quote: ... The labeled complementary RNAs were hybridized onto a whole human genome oligo microarray (4 3 44K; Agilent Technologies). After washing the slides ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 8 µm HPLC column (Agilent) at 60°C with a flow rate of 0.7 mL/min using 0.005 M H2SO4 in ddH2O as eluent ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The custom 8×60k (8 chambers, 60,000 DNA spots per chamber) was synthesized by Agilent Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... Next day membranes were washed for 3 x 5 min and incubated with HRP-coupled secondary antibodies (DAKO) diluted 1:3000 in washing buffer for 1.5 hour at RT ...
-
bioRxiv - Genetics 2023Quote: ... slides were carefully rinsed 3 × 5 min with PBS and slides were mounted with Fluorescent Mounting Medium (Dako) and examined under fluorescence using a Zeiss microscope equipped with an AxioCam HRm camera.
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Bioengineering 2022Quote: ... 8 µm HPLC column (Agilent Technologies). Samples of culture supernatants were diluted twice with milliQ water with 50 mM H2SO4 ...
-
bioRxiv - Genetics 2023Quote: ... or goat serum (DAKO, cat.no.X090210-8), followed by incubation with primary antibody (overnight ...
-
bioRxiv - Bioengineering 2023Quote: ... 8 µm HPLC column (Agilent Technologies). Analyses were performed using the following conditions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 8 µm HPLC column (Agilent Technologies). Collected bacterial cultures were centrifuged at 20,000 g for 10 min ...
-
bioRxiv - Genomics 2022Quote: ... RT was performed with a specific primer (5′-CCTACACGACGCTCTTCC-3′) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). RNA degradation was performed by incubating the RT mixture with 10% 1 M NaOH (2μl of RT mixture ...
-
bioRxiv - Biochemistry 2024Quote: ... 50 µl of the sample was injected onto a BioSEC-3 300 or BioSEC-5 1000 column (Agilent Technologies) pre-equilibrated with PBS or 10 mM histidine ...
-
bioRxiv - Microbiology 2022Quote: ... 30 sec at 60°C (steps 3 and 4 were repeated 40 times) was done with the AriaMX real-time PCR System (Agilent).
-
bioRxiv - Cancer Biology 2024Quote: ... the AFC (7-amino-4-trifluoromethyl coumarin) fluorescent signals were measured on a Cytation 5 instrument (Agilent Technologies) using the fluorometer function (410-20nm excitation bandwidth ...
-
bioRxiv - Molecular Biology 2020Quote: Per2AS variant 2 overexpression plasmid was generated from 5’RACE and 3’RACE products that were cloned in to pBluescript (Agilent), as well as Per2AS qPCR product cloned into pGEM-T (Promega) ...
-
bioRxiv - Genetics 2021Quote: ... Additional sequences were added to the 5’ (ACTGGCCGCTTGACG-) and 3’ (-CGCAGGAGCCGCAGTG) ends of each fragment and synthesized in a 100K pool by Agilent Technologies (Supplementary Table S2) ...
-
bioRxiv - Biochemistry 2020Quote: ... Selected mRNAs were purified and reverse-transcripted into single-chain DNA with the primer 5’-CTTCAGTTGCCGCTTTCTTTCTTG-3’ using a reverse transcriptase (Cat 200436, Agilent). The resulting cDNA library was purified using a DNA purification kit (Cat A740609.25 ...
-
bioRxiv - Cell Biology 2020Quote: ... were changed to 5′-ACCTGCAAAG −3′ by using the Quick-Change site directed mutagenesis Kit (Stratagene, La Jolla, CA, USA). Expression vectors for SENP2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... pCS2+-5’HA-sobp and pCS2+-sobp-3’HA were generated using the QuikChange lightning Site-directed mutagenesis kit (Agilent). The same kit was used to sequentially remove three nucleotides located at the 5’ end of the pCS2+-3’HA-sobp ORF to generate a construct whose transcribed mRNA does not bind to the designed translation-blocking antisense morpholino oligonucleotide (pCS2+-sobpMOI-3’HA ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV X1 C35G R (5’-GCCTGCTAGTCAGGCACAGCTTGGGGA-3’) were used with a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) to introduce the X1 C10415G mutation into the p2-ZIKV plasmid ...
-
p97/VCP induces GLI1 to control XBP1-dependent endoplasmic reticulum stress transcriptional responsebioRxiv - Cancer Biology 2021Quote: ... The cells were washed 3 times with PBS for 5 min and then incubated with a secondary antibody: Flex-HRP (EnVision System, Dako) for 30 min and washed 3 times 5 min with PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... USP47 catalytic domain was mutated by changing cysteine 177 into alanine (C177A) using the sense primer (5’-gtttgcaaaaggctattcaaataggcagtcattgcttggtttactagtcc-3’) using Quickchange Lightning Site-directed Mutagenesis Kit from Agilent technologies ...
-
bioRxiv - Bioengineering 2024Quote: ... and cells were imaged every 3 hours for 48 hours using a Cytation 5 cell imaging multimode reader (Agilent Technologies) .
-
bioRxiv - Biochemistry 2024Quote: ... The forward gRNA g53BP1-1 5’AGACCTCTAGCTCGAGCGCGAGG 3’ and a reverse gRNA g53BP1-7 5’GTCCCTCCAGATCGATCCCTAGG 3’ were cloned into pU6-Puro via site-directed mutagenesis using the QuickChange method (Stratagene) cloned using the previously described methodology86,87 and confirmed by DNA sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... a mutant version of each of the hsdR1 had a unique BamHI site inserted by site directed mutagenesis of a C at position 1033 of hsdR1 to a G using oligonucleotide directed mutagenesis (5’-CATCAGAGACTTTTTTAGCGGATCCAACCTAAACAAAAAGAC-3’) (Quick-Change Lightning. Agilent). The mutated site is shown in bold and italics and the generated BamHI site is underlined ...