Labshake search
Citations for Agilent :
1 - 50 of 1972 citations for 3 4 Ethoxy 3 methoxy phenyl 3 thiophene 2 carbonyl amino propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... 3’-3-Diamino-benzidine (DAB+, Dako) was used as substrate chromogen ...
-
bioRxiv - Microbiology 2021Quote: ... and the AEC substrate 3-amino-9-ethylcarbazole (Dako, Carpinteria, CA). Moreover ...
-
bioRxiv - Microbiology 2021Quote: ... followed by the red 3-amino-9-ethylcarbazole (AEC) HRP substrate (Dako) and counterstaining with haematoxylin ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were developed with 3′3-diaminobenzidine (DAKO Cytomation), following the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: ... and 3-3′-diamino-benzidine-tetrahydrochloride (DAB, Dako, K3468) revelation.
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μM of Carbonyl-cyanide-4 (triflouoromethoxy) phenylhydrazone (FCCP) (Agilent) was added ...
-
bioRxiv - Bioengineering 2021Quote: ... were extracted from freeze-dried sludge samples with a 3 h digestion time and 3% sulfuric acid and then analyzed by a gas chromatography-mass spectrometry (GC-MS) (Agilent, USA) with 7890A-5975C model (Lanham et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoreactions were visualized using 3-amino-9-ethylcarbazole containing hydrogen peroxide (DAKO, Tokyo, Japan).
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Carpinteria, CA, USA). The sections were counterstained with Mayer’s haematoxylin and coverslipped ...
-
Dual MAPK and HDAC inhibition rewires the apoptotic rheostat to trigger colorectal cancer cell deathbioRxiv - Cancer Biology 2021Quote: ... Chromagen was developed using the DAB (3, 3-diaminobenzidine) reagent (Dako). Sections were counter-stained using pre-filtered Mayer’s haematoxylin (Amber Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Antigen–antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with haematoxylin (Dako ...
-
bioRxiv - Cell Biology 2020Quote: ... Antigen-antibody complexes were revealed with 3-3’-diaminobenzidine (K3468, Dako). Sections were counterstained with hematoxylin (Dako ...
-
bioRxiv - Physiology 2022Quote: ... Antigen–antibody complexes were revealed with 3-3′- diaminobenzidine (K346811, Dako) or the DAB (Polymer ...
-
bioRxiv - Cell Biology 2024Quote: ... at 1:500 and 3-3’-diamino-benzidine-tetrahydrochloride (Dako, K3468). Stained sections were imaged using an NanoZoomer 2.0HT (Hamamatsu).
-
bioRxiv - Cancer Biology 2024Quote: ... Antigen–antibody complexes were reveled with 3-3′-diaminobenzidine (K346811, Agilent). Sections were counterstained with hematoxylin (CS700 ...
-
bioRxiv - Microbiology 2021Quote: ... A bright red chromogen labelling was produced with 3-amino-9-ethylcarbazole substrate (AEC, DAKO). Sections were counterstained with Mayer’s haematoxylin ...
-
bioRxiv - Pathology 2024Quote: ... Slides were visualized with 3-amino-9-ethylcarbazole chromogen (Ready-to-Use, K3464, Dako, CA), and counterstained by Mayer’s Hematoxylin ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Microbiology 2021Quote: ... Tissue sections were colored via DAB-staining (3, 3-diaminobenzidine; Dako, K3468).
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-Diaminobenzidine (DAB, Agilent) and then counterstained with haematoxylin (Abcam) ...
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA). Sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Immunology 2021Quote: ... followed by exposure to 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA). Sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Immunology 2023Quote: ... Immunolabeling was visualized by 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA), producing a red-brown signal and sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Immunology 2023Quote: ... Immunolabeling was visualized by 3-amino-9-ethylcarbazole substrate (AEC, Dako, Agilent, Santa Clara, CA, USA), producing a red-brown signal and sections were counter-stained with Mayer’s hematoxylin ...
-
bioRxiv - Cancer Biology 2023Quote: ... in 3 cycles for 3 hours using the Seahorse XFe24 analyzer system (Agilent Technologies). Inhibitors and substrates were used at the following concentrations ...
-
bioRxiv - Microbiology 2023Quote: ... 3 × 150 mm column (Agilent), column temperature 50 °C ...
-
bioRxiv - Microbiology 2020Quote: ... with products monitored every 2 to 3 cycles on a TapeStation (Agilent) to ensure correct fragment sizes (∼500bp) ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Cell Biology 2021Quote: ... 3-diaminobenzidine (DAB) solution (Dako, USA) until signal was detected ...
-
bioRxiv - Cancer Biology 2022Quote: ... and KI67 (clone TEC-3, Dako) were then incubated on the tissue slices and bound antibody was detected with biotinylated goat anti-rat IgG (Southern Biotechnology) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’-diaminobenzidine tetrahydrochloride (DAB; Dako, K3467), as chromogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’ diaminobenzidine (DAB) (Dako, Carpinteria, CA) and counter-staining was done with hematoxylin ...
-
bioRxiv - Biochemistry 2023Quote: ... or a BIOSEC 3 column (Agilent; flow rate ...
-
bioRxiv - Molecular Biology 2022Quote: 3*10^3 of HPLFs per well were seeded into Seahorse XFe96 well plate (Agilent Technologies, 200941) for overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... Step 3 was endogenous peroxidase blocking (Dako REAL Peroxidase-blocking reagent ...
-
bioRxiv - Microbiology 2021Quote: ... and then with streptavidin-HRP complex followed by 3,3-diaminobenzidine or 3-amino-9-ethylcarbazole detection (LSAB kit, Dako France). Sections were then counterstained with hematoxylin ...
-
bioRxiv - Microbiology 2024Quote: ... Amplicons (each 3-4 kbs in length) were generated via PCR using EasyA polymerase (Agilent) and Sanger sequenced.
-
Machine learning and data-driven inverse modeling of metabolomics unveil key process of active agingbioRxiv - Systems Biology 2024Quote: ... Gas separation was performed on the HP-5MS column (30 m 3 0.25 mm 3 0.25 mm, Agilent Technologies).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...
-
bioRxiv - Pathology 2021Quote: ... 3′-diaminobenzidine tetra-hydrochloride chromogen (DAB, K3468, Dako) was added to all sections and the reaction was stopped with distilled water ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 3’ Diaminobenzidine (DAB) solution (Dako Agilent Pathology Solutions) was applied for eight minutes ...