Labshake search
Citations for Agilent :
1 - 50 of 4828 citations for 2R 5S 5 4 amino 5 fluoro 2 oxopyrimidin 1 2H yl 1 3 oxathiolan 2 yl methyl butyrate WXC04778 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Microbiology 2021Quote: ... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-mouse IgG (1.3 μg ml−1, 5% milk in PBST; Dako, P026002-2) or goat anti-rabbit IgG (250 ng ml−1 ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Bioengineering 2022Quote: ... Cell nuclei were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) for 5 min before being mounted using DAKO mounting medium (Agilent, catalog no. S302380–2). Imaging of the histological samples was performed on the Microscope Axio Imager.A2 (Carl Zeiss Microscopy ...
-
bioRxiv - Molecular Biology 2024Quote: ... HP-5 MS column (5% phenyl methyl polysiloxane: 30m x 0.25mm i.d. x 0.25 µm, Agilent technologies) was used for metabolite separation ...
-
bioRxiv - Neuroscience 2024Quote: ... 2) anti-fibrinogen (1/500) (Dako, A008002-2), 3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Synthetic Biology 2021Quote: 2-methyl tryptophan was quantified by an LC-MS system (Agilent) using an XBridge BEH Amide 2.5 μm (Waters ...
-
bioRxiv - Cell Biology 2021Quote: ... sections were incubated for 2 hours at room temperature with polyclonal guinea pig anti-insulin antibody (1:5, Agilent Technologies). Slides were then washed 3 x 5 minutes with PBS and incubated with the Anti-guinea pig IgG Alexa Fluor 488 (1:200 ...
-
bioRxiv - Immunology 2023Quote: ... and 1-2×105 T cells per well were attached in 5-8 replicates in Seahorse XF RPMI medium (Agilent) supplemented with 2 mM L-glutamine (Gibco) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with a KpnI site inserted at the 5’ end of Δ3-1 or Δ3-2 (Quick Change Site-Directed Mutagenesis from Stratagene) using the oligonucleotides Δ3-1-KpnI Fw ...
-
bioRxiv - Cancer Biology 2024Quote: ... the AFC (7-amino-4-trifluoromethyl coumarin) fluorescent signals were measured on a Cytation 5 instrument (Agilent Technologies) using the fluorometer function (410-20nm excitation bandwidth ...
-
bioRxiv - Molecular Biology 2020Quote: Per2AS variant 2 overexpression plasmid was generated from 5’RACE and 3’RACE products that were cloned in to pBluescript (Agilent), as well as Per2AS qPCR product cloned into pGEM-T (Promega) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Insulin (1:2, Dako IR002), Integrin-α6 (1:400 ...
-
bioRxiv - Microbiology 2023Quote: ... approximately 2 µg of protein was injected on a Zorbax Poroshell 300SB-C8 column (5 µm, 300Å, 1×75mm IDxL; Agilent Technologies) and separated using a 15 min gradient from 5% to 80% solvent B at a flow rate of 100 µl/min (solvent A ...
-
bioRxiv - Cell Biology 2023Quote: ... bordered (∼ 5 x 2 cm rectangle) with a hydrophobic fat pen (Dako). A glass coverslip ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were washed and incubated with rabbit anti-goat IgG (500 ng ml−1, 5% milk in PBST; Dako, P044901-2), rabbit anti-mouse IgG (1.3 μg ml−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... Ki67 (Dako #M724001-2, 1:200). Full immunohistology protocol details available at http://help.brain-map.org/download/attachments/8323525/CellTypes_Morph_Overview.pdf?version=4&modificationDate=1528310097913&api=v2
-
bioRxiv - Neuroscience 2021Quote: ... CD31 (Agilent, GA61061-2, 1:100), Olig2 (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... for 5 minutes at room temperature and Oligo aCGH Wash Buffer 2 (Agilent) for 1 minute at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... Grids were then washed with PBS and blocked with 1% FBS for 5 min Grids were subsequently incubated with rabbit anti-CEA (Dako, supplemental table 2) for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... were seeded at 6,000 cells per well in 80 µL of MEM media (MEM 10% FBS + 1% P/S + 1 mM Sodium Pyruvate + 2 mM Glutamax + 1% nonessential amino acids + 50 µg/mL uridine) in a Seahorse 96-well cell culture plate (Agilent, USA). After 24 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:600 (ref Z033401-2, Agilent Dako) for 24 hours at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:600 (ref Z033401-2, Agilent Dako) for 24 hours at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-GFAP (1:5000, Dako, Z033401-2), anti-SOX6 (1:2000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... slides were blotted with the following primary antibodies: anti-insulin (IR00261-2, 1:4; Agilent Techologies) and anti-glucagon (g2654 ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were incubated for 2h with primary antibody diluted in Blocking Buffer with 5% Goat Serum (Dako #X090710) (antibodies are dilutions used are listed in Table 2) ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-MPO (1:200, A039829-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Microbiology 2021Quote: ... rabbit anti-CD3 (1:200, A045229-2, Dako Agilent Pathology Solutions ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM Pyruvate and 2 mM Glutamine (Agilent; 103015-100 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and anti-GFAP (1:5,000, Dako, Z033401-2). The next day ...
-
bioRxiv - Immunology 2021Quote: ... stained with hematoxylin (Agilent, S330930-2, 1 mL), and incubated at room temperature for 7 min ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-CD31 (1:200 dilution, M082329-2, Dako), Goat anti-Rabbit IgG Cross-Adsorbed Secondary Antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-Gfap (1:1000, Agilent #Z033401-2); rabbit anti-alpha-Sma (1:200 ...
-
bioRxiv - Neuroscience 2024Quote: ... For GFAP (1:1000, Agilent Technologies, Z033429-2), Iba1 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... and GFAP rabbit (1:500, DAKO, Z033429-2) were used ...
-
bioRxiv - Developmental Biology 2022Quote: ... and anti-SMA (M085129-2, 1:1000, Agilent). All commercial antibodies are validated by vendors ...
-
bioRxiv - Genomics 2024Quote: ... and GFAP (1:1000, Rabbit, DAKO, Z033401-2). Following primary antibody incubation sections were washed 4×2 minutes with TBST and stained with species-appropriate secondary antibody conjugated to a Horseradish Peroxidase (HRP ...
-
bioRxiv - Cancer Biology 2024Quote: ... CD68 (clone KP1; 1:100; M087629-2, DAKO), and Ki67 (clone SP6 ...
-
bioRxiv - Cancer Biology 2024Quote: ... CD4 (clone 4B12; 1:50; M731001-2, DAKO), FOXP3 (clone D2W8E ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-S100β (1:1000, Agilent, GA50461-2), chicken anti-NF200 (1:1000 ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Cancer Biology 2023Quote: Murine glioma cells (similar low passage N1IC-1/2 and p53-1/2) were seeded in PLL coated XFe24 cell culture microplates (Agilent TEchnologies) at 1.8ᵡ104 cells per well in 250μL BFP (n=10 technical replicates for the baseline experiment and n=5 technical replicates for the cysteine/methionine deprivation experiment ...
-
bioRxiv - Biochemistry 2020Quote: ... using the enzymes α(2–3) sialidase (Prozyme), α(2–3,6,8 ...
-
bioRxiv - Immunology 2023Quote: ... Images were acquired (1-5 images per subject) using the Cytation 5 Cell Imaging MultiMode Reader (Agilent). Images were processed to quantify fluorescence intensity using Gen5 software package 3.08.
-
bioRxiv - Bioengineering 2021Quote: ... The GC-MS system used was the 7890-5975C from Agilent in combination with the HP-5MS column (5% phenyl methyl polysiloxane, 30m×0.25mm ID, 0.25µm) from Agilent. The temperature was maintained at 180 °C for 1 min ...