Labshake search
Citations for Agilent :
1 - 50 of 4022 citations for 1 Boc 4 chloro 5 formyl 3 6 dihydro 2H pyridine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... a J2-4 reverse primer 5’-(GGATAGATCTCTGAGGAGACGGTGACCAGGAG-3’) and HERC II polymerase (Agilent), following the manufacturer’s recommended reaction conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were incubated for 2h with primary antibody diluted in Blocking Buffer with 5% Goat Serum (Dako #X090710) (antibodies are dilutions used are listed in Table 2) ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent ...
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Accuscript reverse transcriptase (6×10−5) (Agilent, product literature), and Phusion DNA polymerase after 20 cycles of amplification (1.2×10−5 ...
-
bioRxiv - Systems Biology 2020Quote: ... block 3-6: PCR amplification from the synthetic library (Agilent Technologies) according to mutation families) ...
-
bioRxiv - Biochemistry 2023Quote: ... shRNAs against mouse ACOT12 (#5, #6 and #7) and mouse ACOT8 (#1 and #2) were also constructed in pAdEasy-1 (Stratagene) for adenovirus packaging based on The AdEasyTM Technology (He et al. ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Developmental Biology 2024Quote: ... By site-directed mutagenesis the V5 tag of the pMT-Bip V5-His A vector was replaced by a Myc sequence (EQKLISEEDL) using the primers: Fw: 5’– AGCGAAGAGGATCTGACGCGTACCGGTCATCAT–3 and 5’– AATCAGTTTCTGTTCGAATTCCACCACACTGGACTAGTAGGTACC–3’ and the PFU ultra (Agilent). The cDNA for Drospondin without the signal peptide sequence and the stop codon was amplified using the clone GH02025 from Drosophila Genome Resource Center (DGRC) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4′,6-diamidino-2-phenylindole; 1:1000) was used as nuclei staining and fluorescent mounting medium (DAKO) to cover the slides before imaging acquisition ...
-
bioRxiv - Bioengineering 2022Quote: ... Cell nuclei were then counterstained with 4′,6-diamidino-2-phenylindole (DAPI) for 5 min before being mounted using DAKO mounting medium (Agilent, catalog no. S302380–2). Imaging of the histological samples was performed on the Microscope Axio Imager.A2 (Carl Zeiss Microscopy ...
-
bioRxiv - Plant Biology 2021Quote: ... Dried metabolites were methoximated (20 mg/mL methoxyamine in pyridine) and trimethylsilylated (MSTFA: TMSCI, 99:1) and then analyzed by GC-MS (Agilent 5975, GC/single quadrupole MS). GC-MS data were processed by Agilent MSD ChemStation ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’-TTTAAT-3’à5’-TTggAAT-3’) using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent).
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Biochemistry 2023Quote: ... Site directed mutagenesis was conducted to introduce the oncogenic G12V mutation using a pair of DNA oligos (5’ AGTTGGAGCTGTTGGCGTAGGCAAGAGTGCC 3’) and (5’ GTCAAGGCACTCTTGCCTACGCCAACAGCTCCAACTAC 3’) by following the QuikChangeTM method (Agilent Technologies, La Jolla, CA, USA).
-
bioRxiv - Neuroscience 2020Quote: ... then 2h at RT with a rabbit IgG anti-S100β antibody (1:250; Dako-Agilent, cat# Z031101-2 or between 1:4 and 1:5, Dako-Agilent, cat#IR50461-2) followed by 2h at RT with the chicken IgY anti-Neurofilament medium chain (NF-M ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were digested by DpnI enzyme for 2h at 37°C (Agilent) and loaded on a 1% Agarose Gel ...
-
bioRxiv - Cell Biology 2024Quote: ... at 1:500 and 3-3’-diamino-benzidine-tetrahydrochloride (Dako, K3468). Stained sections were imaged using an NanoZoomer 2.0HT (Hamamatsu).
-
bioRxiv - Synthetic Biology 2022Quote: ... Both oligo libraries (Round 5, and Round 6 + mutational scanning) were purchased from Agilent.
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were washed 3 times (5 min) in TBST prior to addition of secondary antibody (goat anti-rabbit HRP 1:10,000; Dako - P00448). Blots were washed 3 times in TBST prior to development using SuperSignal West Pico Plus substrate (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... β1-4 galactosidase (Agilent Technologies), or double digestion with Sialidase A and β-galactosidase ...
-
bioRxiv - Immunology 2024Quote: ... β(1-4)-Galactosidase (Prozyme) (designated as “G”) ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Bioengineering 2024Quote: ... 12 by PCR using primers 3 and 4 listed in Supplementary Table 1 and cloned into the BamHI-KpnI site of pBluescript II KS (+) (Stratagene, CA, USA) using ligation mix (Takara Bio USA) ...
-
bioRxiv - Physiology 2021Quote: HUVECs (passages 4-6) were seeded in XFe 24 well plates (Agilent, Santa Clara, CA, USA) at 30,000 cells per well in 200 µL EGM for 48 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Insulin (Agilent, IR-002, 1:4), and Glucagon (Sigma Aldrich ...
-
bioRxiv - Physiology 2022Quote: ... [U-13C]-palmitate enrichment and [1,1,2,3,3-2H]-glycerol enrichment were measured by GC-MS/MS (Agilent GC model 7890A and Waters Quattro Micro) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Guinea Pig anti-Insulin pre-diluted 1:6 (Dako 1R002), Chicken anti-GFP 1:1000 (Abcam ab13970) ...
-
bioRxiv - Microbiology 2024Quote: ... Amplicons (each 3-4 kbs in length) were generated via PCR using EasyA polymerase (Agilent) and Sanger sequenced.
-
bioRxiv - Cancer Biology 2020Quote: ... Barcoded cDNA libraries containing 5-6 LMD samples plus a Universal Human Reference RNA (UHR) standard (Stratagene) were prepared on the Ion Chef System using the Ion Ampliseq Chef DL8 materials and the Ion AmpliSeq Transcriptome Human Gene Expression Panel Chef-ready Kit (Thermo Fisher) ...
-
bioRxiv - Microbiology 2023Quote: ... membranes were incubated for 2h at room temperature with Horse Radish Peroxidase (HRP)-conjugated αMouse antibodies (Dako). After washing with TBS-Tween ...
-
bioRxiv - Cancer Biology 2024Quote: ... (4) CD68 (Macrophages, 1:400, M0876; Dako)–Opal 620 ...
-
The integrated stress response promotes macrophage inflammation and migration in autoimmune diabetesbioRxiv - Immunology 2024Quote: ... and anti-insulin (Dako; IR002; 1:4) antibodies ...
-
bioRxiv - Cancer Biology 2023Quote: ... mouse anti-Krt5/6 (1:200; M7237; Agilent; Santa Clara, CA), and mouse anti-Krt14 (1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... Secondary antibody incubation lasted 2h and was followed by avidin-biotin complexes for signal amplification (ABC kit, Dako). Immunoreactivities were visualized using 3,3’-diaminobenzidine as a chromogen ...
-
bioRxiv - Neuroscience 2022Quote: ... slides were incubated for 5 minutes with DAPI (4’, 6-diamidino-2-phenylindole, 0.5ug/mL in 1X PBS) and were mounted using fluorescence mounting medium (Dako). Negative controls were included in each batch by omitting the primary antibody.
-
bioRxiv - Genomics 2020Quote: ... Ki67 (rat, DAKO M7249, clone TEC-3, 1:100), Carbonic Anhydrase 2 (rabbit ...
-
bioRxiv - Cancer Biology 2024Quote: ... (3) CD8 (Cytotoxic T Cells, 1:400, M7103; Dako)–Opal 570 ...
-
bioRxiv - Physiology 2024Quote: ... tissues were incubated with primary antibody over night at 4°C (guinea pig anti-insulin at 1:4, diluted in 1% goat serum/PBS, Agilent). This was followed by 1-hour incubation with fluorophore-conjugated secondary antibodies (Cy3-anti-guinea pig ...
-
bioRxiv - Plant Biology 2024Quote: ... dissolved in 15 µl pyridine and derivatized with 30 µl N-methyl-N-(trimethylsilyl)trifluoracetamid (MSTFA) before being analyzed by GC-MS (Agilent 7890B GC-Agilent 5977N-MSD) as previously described (Berghoff et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse anti-human CD20 (Dako, clone L26, 1:1000, pH 6 retrieval), mouse anti-human FOXP3 (Abcam ...
-
bioRxiv - Cell Biology 2024Quote: ... and anti-insulin antibody (Dako IR002; 1:4). Highly cross-adsorbed Alexa Fluor secondary antibodies (ThermoFisher ...
-
bioRxiv - Neuroscience 2021Quote: ... Lipids were resolved on a 3 150 mm XDB-C8 column (5 μM particle size) (Agilent) at flow rate 0.4 mL/min ...
-
bioRxiv - Molecular Biology 2020Quote: ... with a specific primer (5’-CCTACACGACGCTCTTCC-3’) using AffinityScript Multiple Temperature cDNA Synthesis Kit (Agilent Technologies). Then ...
-
bioRxiv - Biochemistry 2020Quote: ... WH1-2 (922μM) and WH3-4 (3691μM) were passed through a Bio SEC-3 HPLC column (Agilent) at 0.2ml/min in 50mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2020Quote: ... were induced with 2μg/mL doxycycline for 6 hours prior to crosslinking at 100mJ/cm2 at 4°C in a Stratalinker 1800 (Stratagene). Cells were then processed according to the eCLIP protocol for input and immunoprecipitated samples until cDNA was obtained ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were then washed twice with DPBS and mounted using DAKO fluorescent mounting medium containing 4’,6-diamidino-2-phenylindole (DAPI; Agilent). For visualisation of endogenous TDP-43 and FUS ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 6 (DAKO), for 10 min in a pressure cooker ...
-
bioRxiv - Neuroscience 2024Quote: ... pH 6 (DAKO), for 20 min in a pressure cooker ...