Labshake search
Citations for Agilent :
351 - 400 of 3528 citations for 1 2 Bis Pentabromophenyl Ethane Unlabeled 25 Ug Ml In Toluene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: ... stained with hematoxylin (S330130-2, Agilent) and stored at 4 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... High pH (Agilent DAKO, K800421-2) for DKC1 slides and EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Cancer Biology 2023Quote: ... Low pH (Agilent DAKO, K800521-2) for Ki67 slides ...
-
bioRxiv - Cancer Biology 2023Quote: ... Low pH (Agilent DAKO, K800521-2) for Ki67 slides ...
-
bioRxiv - Cancer Biology 2023Quote: ... High pH (Agilent DAKO, K800421-2) for DKC1 slides and EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 10x AffinityScript buffer (Agilent), 2 μl 0.1 M DTT ...
-
bioRxiv - Genomics 2022Quote: ... Mayer’s Hematoxylin (Agilent Technologies, S330930-2) was removed from each well and then each section was washed with 75µL of RNase and DNase free MQ water ...
-
bioRxiv - Physiology 2023Quote: ... and DAB (K346811-2; Agilent Technologies). Slides were counter stained with Mayer’s Hematoxylin (TA-125-MH ...
-
bioRxiv - Cancer Biology 2023Quote: ... protein blocker (Agilent Technology, X090930-2). Slides were incubated with a biotinylated anti-pimonidazole mouse IgG1 monoclonal antibody diluted 1:50 in Background Sniper (Fisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... Epoch 2 (BioTek, now: Agilent Technologies) or Infinite 200 Pro (TECAN trading AG ...
-
bioRxiv - Immunology 2023Quote: ... 2 and the QuikChangeII kit (Agilent) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µl Herc II polymerase (Agilent), and 35 µl nuclease-free water were added to the 40 µl gDNA ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM glutamine (103579; Agilent Technologies) and 1 mM sodium pyruvate (103578 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM glutamine (Agilent 103579-100), and 10 mM glucose (Agilent ...
-
bioRxiv - Microbiology 2024Quote: ... HRP kit (Agilent DAKO, K400111-2) or the EnVision+/HRP ...
-
bioRxiv - Microbiology 2024Quote: ... HRP kit (Agilent DAKO, K400111-2) or the EnVision+/HRP ...
-
bioRxiv - Cell Biology 2024Quote: ... Rabbit Linker (Agilent Cat#GV80911-2). Epitope Retrieval Solution 1 (Leica Cat#AR9961) ...
-
bioRxiv - Cell Biology 2024Quote: ... ‘Normal’ block (Agilent Cat#S202386-2), EnVision FLEX TRS High pH (Agilent Cat# GV80411-2) ...
-
bioRxiv - Neuroscience 2024Quote: ... Tau Dako (Agilent Technologies, #A002401-2), C-Myc (Cell Signaling Tech ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 mM L-glutamine (Agilent) and the cells were placed in a non-CO2 incubator set at 37°C for approximately 1 h before starting the assay ...
-
bioRxiv - Cancer Biology 2024Quote: ... Serum-Free (Agilent Dako, X090930-2) for 10 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... Serum-Free (Agilent Dako, X090930-2) for 10 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 mM XF Glutamine (Agilent), and then cells were incubated in a CO2-free incubator for 1 hr ...
-
bioRxiv - Immunology 2024Quote: ... 2 mM glutamine (Agilent, 103579-100), 10 mM glucose (Agilent ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the cells were washed twice with 200 μL/well of assay medium (XF DMEM Base Medium, pH 7.4 containing 25 mM Glucose and 4 mM Glutamine; Agilent). After washing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Genomic DNA was extracted from approximately 25 mg of liver tissue using the RecoverEase DNA Isolation Kit (Agilent Technologies). The λ-EG10 phage were packaged in vitro from genomic DNA using Transpack packaging extract (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2019Quote: ... 25 μg of peptides were loaded unto 20 cm capillary columns packed with 5 μM Zorbax SB-C18 (Agilent), which was connected using a zero dead volume 1 μm filter (Upchurch ...
-
bioRxiv - Microbiology 2020Quote: ... Reactions were set up in a 25 µl total volume with 12.5 µl Brilliant SYBR Green qPCR Master Mix (Agilent), 0.4 µM of each primer and 5 µl of prediluted DNA ...
-
bioRxiv - Biochemistry 2020Quote: Samples were diluted in 25% ACN 0.3%TFA and loaded onto a 50×4.6 mm PLRP-S 300A column (Agilent Technologies) connected to an Accela pump (Thermo Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... 25 μl of ds-cDNA was brought to a final volume of 53 μL in elution buffer (Agilent Technologies) and sheared on a Covaris LE220 (Covaris ...
-
bioRxiv - Immunology 2023Quote: ... Reactions were performed in a 25 μl reaction mix comprising 1X Taqman Brilliant III master mix (Agilent, Stockport, UK), 0.2 pmol/μl forward primer (CCAACCGTGTGTTTCCTCCT) ...
-
bioRxiv - Plant Biology 2023Quote: ... A gradient elution system was optimized with the two mobile solvents to separate metabolites on an Eclipse XDB-C18 analytical column (250 × 4.6 mm, 5 µM, 25 ◦C, Agilent). The gradient solvent system was composed of ratios of solvent A to B ...
-
bioRxiv - Systems Biology 2023Quote: ... pH 8.5) and loaded onto an Agilent 300 Extend-C18 column (5 μm, 4.6 mm × 25 cm; Agilent Technologies). The peptides were then resolved using an increasing gradient of solvent B (10 mM TEAB in 90% acetonitrile (ACN) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and an Agilent 7693A autosampler fitted with a 100 μL gastight syringe was used to inject headspace gas (50 μL) into either a PoraPLOT Q capillary column (25 m, 0.25 mm ID, 8 μm film; Agilent) or a DB-VRX capillary column (20 m ...
-
bioRxiv - Developmental Biology 2020Quote: ... Secondary antibodies (HRP linked) were swine anti–rabbit (P039901-2) and goat anti–mouse (P044701-2) (DAKO). Imaging was done using SuperSignal West Femto (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: ... and bound serum IgG was detected by 70 µL/well of 1:3000 diluted rabbit anti-human IgG antibody linked to horseradish peroxidase (Agilent, P021402-2) incubated for 2h at RT ...
-
bioRxiv - Developmental Biology 2019Quote: ... and incubated for 2 hours at room temperature with a biotinylated goat anti-rabbit secondary antibody (Dako, 1:500 in blocking solution). Cells were washed 3 times and incubated for 30 minutes with streptavidin Cy3 (Sigma ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by overnight staining with 1:300 dilutions of rat-anti-C-peptide (DSHB; GN-ID4-S) and mouse-anti-CD31 (Dako; M082329-2) primary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... the co-cultures were incubated first with primary antibody for glial fibrillary acidic protein (GFAP, 1:400, Z033429-2, Dako, Glostrup, Denmark) prepared in 5% NGS in DPBS overnight at +4 following an incubation with Alexa Fluor405 (A31556 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and incubated for 30 minutes at room temperature with the secondary antibody (Supplementary Table 2)(1:500 diluted in DAKO Antibody Diluent). Cells were washed with 0.2% Triton X-100 in PBS ...
-
bioRxiv - Microbiology 2021Quote: ... were designed based on the DNA sequence for SARS-CoV-2 Wuhan-Hu-1 using the QuickChange Primer Design tool (Agilent Technologies, Inc.). Mutagenesis was carried out on a pCDNA-SARs2 Wuhan-Hu 1 S plasmid to create the P681H mutation ...
-
bioRxiv - Microbiology 2020Quote: ... Sections were then incubated with the primary antibody (diluted at 1 µg/ml in Antibody Diluent [Dako, Carpinteria, CA]) for 30 min at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... Optical absorption spectra of the samples in a 300-900 nm range were recorded within about 10 s at given time intervals (about 0.3-1.0 min) in a 3 mL quartz cuvette (Helma QS1000, 1 cm pathlength) using a Cary 60 spectrometer (Agilent). Alternatively ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... MG and TA99 were used at a concentration of 1µg/ml together with a rabbit anti-human Von Willebrand Factor (1:800, Dako) in 3% BSA in PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... and followed by incubation with primary antibodies or negative isotype controls diluted in blocking buffer for 1 hour (Covance PRB-278P rabbit polyclonal IgG anti-PAX6, 10μg/mL; Dako Z0334 rabbit polyclonal IgG anti-GFAP ...
-
bioRxiv - Plant Biology 2020Quote: ... The powder (1 g) was immediately transferred to a 20-mL head-space vial (Agilent, Palo Alto, CA, USA) containing 2 mL NaCl-saturated solution to inhibit any enzyme reaction ...
-
bioRxiv - Biophysics 2020Quote: ... in 20 min at a flow rate of 0.4 mL min-1 using a Zorbax Narrow Bore (2.1×50 mm, 5 μm) C18 column (Agilent Technologies).
-
bioRxiv - Biochemistry 2022Quote: ... Sample from each PNT3 variant at 5 mg mL-1 in buffer B containing 6M GDN was injected onto an AdvanceBio SEC 2.7 µm (Agilent) SEC column ...
-
bioRxiv - Developmental Biology 2023Quote: ... the beads were transferred into a 1-mL PP filtration microplate (Agilent, 7 µm frit, cat. no. 202501-100) and washed 3x with 200 µL 1x PBS and 2x 200 µL ultrapure water ...
-
bioRxiv - Immunology 2023Quote: ... Rabbit anti-goat IgG (P044901-2) or goat anti-rabbit IgG (P044801-2) secondary antibodies were from Agilent.