Labshake search
Citations for Agilent :
4751 - 4800 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... The bound crystal violet was resolubilized with 100 μl 95% ethanol for 10 min and quantified via OD595 with BioTek Synergy H1 (Agilent Technologies). Each strain was tested with 30 technical replicates.
-
bioRxiv - Biochemistry 2024Quote: ... pre-incubated for at least 30 min at 6 °C within the Vialsampler (G7129A, Agilent), and then loaded on a Superdex 200 Increase 10/300 column (Cytiva ...
-
bioRxiv - Biochemistry 2024Quote: ... The elution profiles were followed by intrinsic fluorescence at 340 nm excited at 290 nm using a 1260 FLD spectra detector (G7121B, Agilent) and then normalized to 0,1.
-
bioRxiv - Biochemistry 2024Quote: ... coli BL21Gold (DE3) cells (Agilent Technologies). Expression was performed at 30°C overnight after induction with 1 mM Isopropyl β-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was placed in an MS tube (Agilent 5188-2788) for downstream analysis.
-
bioRxiv - Biochemistry 2024Quote: ... Chromatograms were integrated using MassHunter software (Agilent, Santa Clara, CA, USA). Absolute concentrations were calculated via standard addition ...
-
bioRxiv - Biochemistry 2024Quote: ... each histone was expressed in BL21 (RIL) DE3 (Agilent) for 3 h at 37°C induced by 1 mM IPTG ...
-
bioRxiv - Biochemistry 2024Quote: ... Total fatty acyl groups from 1 mg cerebellar protein were quantitated as their pentafluorobenzyl derivatives on a Capillary Gas Chromatography-Electron-Capture Negative-Ion Mass Spectrometry (GC/MS) system (Agilent, USA) with a Supelco SP2560 capillary column (50m X 0.25mm x 0.2µm ...
-
bioRxiv - Biochemistry 2024Quote: ... coupled to quadruple time of flight mass spectrometry (1290 UHPLC / 6550 iFunnel QTOF-MS from Agilent Technologies, Santa Clara, CA, USA) as previously reported by Salehi et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... Bond Elut PBA (phenylboronic acid) cartridge and 96-well plate were purchased from Agilent (Santa Clara, USA). 1 µM of q and Q was spiked in human plasma and extracted with SPE cartridges ...
-
bioRxiv - Biochemistry 2024Quote: Raw data were annotated by Profinder B10.0 (Agilent Technologies) applying the “find-by-formula” algorithm based on monoisotopic mass (5-ppm tolerance for mass accuracy) ...
-
bioRxiv - Biochemistry 2024Quote: ... The spectra of excitation in the 300 - 430 nm region (emission at 468 nm) were recorded using a Cary Eclipse fluorometer equipped with a plate reader accessory (Agilent Technologies, Santa Clara, CA, USA). A detailed description of the assay may be found in our earlier publication [30] ...
-
bioRxiv - Biochemistry 2024Quote: ... coli BL21-CodonPlus (DE3)-RIL competent cells (Agilent) were transformed with cDNAs encoding LST-119–50 or LST-167–98 in the pSMT3 vector ...
-
bioRxiv - Bioengineering 2024Quote: ... then gradually increase the pH by adding NaOH (aq.) to the peptide solution and monitor the turbidity changes by spectrophotometer at the wavelength of 600 nm (Agilent carry3500). When a turbidity appeared ...
-
bioRxiv - Bioengineering 2024Quote: ... coli variant parts were synthesized by Agilent.
-
bioRxiv - Biochemistry 2024Quote: ... The quantification was performed by Agilent MassHunter Quantitative Analysis software (Agilent Technologies, CA, USA).
-
bioRxiv - Pathology 2024Quote: ... Total RNA quality (RNA Integrity Number, RIN) was assessed on an Agilent Bioanalyzer using an RNA Nanochip (2100; Agilent Technologies; Santa Clara, CA). RNA quantity was interpolated from the Agilent chip by using an RNA ladder with a known concentration of 150 ng.
-
bioRxiv - Pathology 2024Quote: ... the above IHC protocol was modified such that the anti-SARS-CoV-2 S primary antibody was at 1:1000 dilution (1 µg/mL) in background-reducing antibody diluent (Dako, S302283-2 ...
-
bioRxiv - Bioengineering 2024Quote: ... SWNT concentration was estimated by UV-Vis spectrophotometry (Agilent Cary 5000) using SWNT absorbance at 632 nm with an extinction coefficient of 0.036 (mg L−1)−1 cm−1.
-
bioRxiv - Biophysics 2024Quote: ... were created using a QuikChange site-directed mutagenesis kit (Stratagene). The phosphomimetic mutants of tau were synthesized by Gene to protein ...
-
bioRxiv - Biochemistry 2024Quote: ... mutagenesis was performed using the QuickChange® Lightning Site-Directed Mutagenesis Kit (Agilent) using the forward primer 5’ CAAACAGATTGTGAGTATAACTACTGGGGCCAG 3’ and the reverse primer 5’ AGTTATACTCACAATCTGTTTGTGGACTCCAACCCG 3’ ...
-
bioRxiv - Biochemistry 2024Quote: ... coli BL21 (DE3) competent cells were purchased from Agilent technologies (USA) ...
-
bioRxiv - Biochemistry 2024Quote: ... These mutations were encoded in oligos with flanking BsaI sites and then ordered as a SurePrint Oligonucleotide library (Agilent Technologies)(Table S6) ...
-
bioRxiv - Microbiology 2024Quote: ... Average library size was determined using a Bioanalyser (Agilent Technologies, San Diego, CA, USA) and quantified with a Qubit 3.0 Fluorometer (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2024Quote: ... The RNA quality was assessed using RNA Nano kit (Agilent). Only tissue with RIN > 7 was used for the spatial analysis.
-
bioRxiv - Neuroscience 2024Quote: ... RNA integrity was assessed with 1µl of each mRNA-purified sample using RNA 6000 Pico kit (Agilent, 5067-1513) on an Agilent Bionalyzer with RNA Integrity Number (RIN ...
-
bioRxiv - Genomics 2024Quote: ... and Femto Pulse System (Agilent, Santa Clara, CA, USA), respectively ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and NucGreen (GFP, excitation 469/20, emission 525/20) were read using a BioTek Cytation imaging reader with Gen5 software (Agilent Technologies, San Diego, CA). Unstained wells were read and used as controls for background fluorescence ...
-
bioRxiv - Pathology 2024Quote: ... integration and quantitative analysis were done using Mass Hunter Quantitative analysis software (Agilent Technologies) based on quantity of internal standard.
-
bioRxiv - Pathology 2024Quote: ... 300 nM of forward and μ reverse primers (Table S5) in AriaMx Real-time PCR System (Agilent) with the following thermal conditions ...
-
bioRxiv - Neuroscience 2024Quote: ... slices were mounted and cover slipped with fluorescence mounting medium containing DAPI (Dako, Santa Clara, USA).
-
bioRxiv - Neuroscience 2024Quote: ... Prepared libraries were quality-controlled using the Bioanalyzer 2100 (Agilent Technologies, USA) and qPCR-based concentration measurements ...
-
bioRxiv - Neuroscience 2024Quote: ... The sequencing libraries were validated on the Agilent TapeStation (Agilent Technologies, Palo Alto, CA, USA), and quantified by using Qubit 3.0 Fluorometer (Invitrogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... the RNA ScreenTape and D1000 ScreenTape kits (both from Agilent Technologies), Qubit RNA HS Assay kit ...
-
bioRxiv - Neuroscience 2024Quote: ... and RNA integrity was checked using Agilent TapeStation 4200 (Agilent Technologies, Palo Alto, CA, USA). ERCC RNA Spike-In Mix kit (ThermoFisher #4456740 ...
-
bioRxiv - Neuroscience 2024Quote: Antibody diluent (Agilent Dako REAL, cat. no. S202230)
-
bioRxiv - Evolutionary Biology 2024Quote: The chromatograms were analyzed using the data analysis software package ‘MSD ChemStation F.01.00.1903’ for Windows (Agilent Technologies, Waldbronn, Germany). The area of each peak was determined by integration and the initial threshold of the integration parameters was set on 15 ...
-
bioRxiv - Neuroscience 2024Quote: Protein A/G/L was purchased from Novus Biologicals (NBP2-34985) and diluted to 1ug/ul with antibody diluent solution (DAKO, S080983-2). Two microliters of mouse or human serum/plasma was incubated with NMDAR1-GLUC and 2 ul of protein A/G/L in 1X PBS ...
-
bioRxiv - Neuroscience 2024Quote: ... Wildtype mouse brain paraffin sections were used for IHC analysis with a dilution of mouse serum at 1:200 with antibody diluent solution (DAKO, S080983-2). Mouse anti-NMDAR1 monoclonal antibody (BD ...
-
bioRxiv - Genetics 2024Quote: ... This was achieved by means of the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) using primers 5’-CTCAGTGTTTTTCGGACTTGCCGCATGC-3’ and 5’-GCATGCGGCAAGTCCGAAAAACACTGAG-3’ in accordance with the manufacturer’s instructions ...
-
TAK1 operates at the primary cilium in non-canonical TGFB/BMP signaling to control heart developmentbioRxiv - Developmental Biology 2024Quote: ... Blocking buffer (DAKO Real Antibody Diluent, #S2022) was added to the samples for 30 minutes before the sections were incubated with primary antibodies (Suppl ...
-
bioRxiv - Pathology 2024Quote: ... One hour of shaking incubation at 30℃ resulted in the extraction of 1 mL of gas for ethylene measurement using gas chromatography (Agilent 7820A, USA).
-
bioRxiv - Neuroscience 2024Quote: ... The catalytic dead mutant PLCXD2- FLAG CD where histidine residues at position 57 and 132 were replaced with leucines was generated by in vitro mutagenesis using the QuikChange II Site-Directed Mutagenesis Kit (Agilent) from PLCXD2-FLAG ...
-
bioRxiv - Genetics 2024Quote: ... RNA concentration and quality was assessed using an Agilent 2100 Bioanalyzer with the RNA Nano 6000 kit (Agilent Technologies, Santa Clara, CA, USA), and only RNA samples with RIN >7 were processed for subsequent cDNA library construction and sequencing ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The HPLC system (1290 Infinity, Agilent Technology, America) was equipped with a DAD detector ...
-
bioRxiv - Neuroscience 2024Quote: Antibody diluent (Agilent Dako REAL, cat. no. S202230)
-
bioRxiv - Bioengineering 2024Quote: UV thermal melting studies were performed on a Cary 3500 UV-Visible Spectrophotometer (Agilent). DNA complexes were annealed at a final strand concentration of 8 μM in 1ξ TAE buffer containing 12.5 mM magnesium acetate ...
-
bioRxiv - Bioengineering 2024Quote: ... The RNA integrity was tested on the Agilent 2100 Bioanalyzer using smallRNA kits (Agilent Technologies). RNA concentrations were calculated by using the Bioanalyzer software ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthetized using the Affinity Script Multiple Temperature cDNA Synthesis kit (Agilent), following manufacturer’s instructions with oligo-dT primers ...
-
bioRxiv - Physiology 2024Quote: ... In each well of XFe96-well microplates (Agilent Technologies, cat no. 102416-100), 15 × 103 HAECs were plated and incubated with 10 nM Gcg ...