Labshake search
Citations for Agilent :
4601 - 4650 of 4735 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Libraries were enriched with 2 cycles of PCR then assessed for size distribution using the 4200 TapeStation High Sensitivity D1000 ScreenTape (Agilent Technologies) and quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher) ...
-
bioRxiv - Immunology 2021Quote: ... Antigen retrieval was performed for 15 min in the autoclave (250°F) using 1x Target antigen retrieval solution (Dako; S169984-2). All antibody steps were performed as described above ...
-
bioRxiv - Immunology 2021Quote: ... Slides were then rinsed with double distilled water (ddH2O) and boiled in 1X Dako pH9 antigen retrieval solution (Agilent, S236784-2) for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were then washed in PBS/0.05% Tween 20 and incubated with rabbit anti human VWF (A008229-2, DAKO/Agilent tech) 1/500 or rabbit IgG isotype control (AB-105-C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the absorbance decrease at 340 nm was immediately measured for 2 minutes in a Cary 60 UV-Vis spectrophotometer (Agilent Technologies) at 23 °C to obtain the initial reaction rate of the enzymes (V0) ...
-
bioRxiv - Neuroscience 2022Quote: ... The absorbance of the samples was measured at 540 nm using a Biotek Epoch 2 microplate spectrophotometer (Agilent, Santa Clara, CA). The standard curve of sodium nitrite (0-100 μM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Peptides were re-dissolved in 100 µL solvent A (0.1% TFA in water/ACN (98:2, v/v)) and injected for fractionation by RP-HPLC (Agilent series 1200) connected to a Probot fractionator (LC Packings) ...
-
bioRxiv - Immunology 2023Quote: ... Endogenous peroxidase was blocked using Peroxidase block (Refine Kit) followed by Protein block (X090930-2, Agilent Technologies Inc., Santa Clara, CA). Primary antibodies were applied at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumor xenograft slides were incubated at 60 °C for 2 h followed by antigen retrieval in a PT Link instrument (Agilent DAKO, PT200) using EnVision FLEX Target Retrieval Solution ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence was mutagenized to obtain the N-ter tag canonical variant 2 through the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent, 200521) using the following DNA primers ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescence spectroscopy measurements of 2 μM of each protein sample were obtained using the Varian Cary Eclipse Fluorescence Spectrophotometer (Agilent Technologies) with an excitation wavelength of 280 nm and recording the emission spectra between 300 nm and 400 nm.
-
bioRxiv - Biochemistry 2023Quote: ... Mutations were introduced into the generated pE-SUMO-α-actinin-2 ABD through site-directed PCR mutagenesis (PfuUltra High-Fidelity DNA Polymerase, Agilent). The following primers were used to introduce cardiomyopathy mutations into the α-actinin-2 ABD sequence.
-
bioRxiv - Microbiology 2023Quote: ... into AAATA in the DENV-2 wild type plasmid (pFK-DVs) was generated using QuickChange XL site-directed mutagenesis kit (Agilent, 200517) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... strains carrying the empty plasmid pME6032 or pME6032 harboring natT or natR copies were grown ON in LB supplemented with Tet 100 μg/ml and then diluted to an OD 0.05 with fresh LB supplemented with different concentrations of IPTG (0 - 250 μM) and grown in microtiter plates in an Epoch-2 reader (Agilent Technologies). 20 mM NAM was supplemented where indicated.
-
bioRxiv - Neuroscience 2023Quote: ... The reaction mixture was incubated for 2 at RT and subsequently applied to a semipreparative RP-HPLC C8 column (Zorbax-300 SB, Agilent, GE) connected to an HPLC system (Agilent 1260 ...
-
bioRxiv - Biochemistry 2023Quote: Mutations were generated by site-directed mutagenesis (table 2) on this plasmid using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) and plasmids were verified through sequencing through the Molecular Informatics Core at the University of Rhode Island.
-
bioRxiv - Cancer Biology 2023Quote: ... harboring the first intron and exon 2 of the coding region was subcloned into pBluescript and mutagenized using Pfu DNA polymerase (Stratagene/Agilent) with primers GAGCTGCTTCCCGCACCGCCCCTGTCCC and GGGACAGGGGCGGTGCGGGAAGCAGCTC ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.50 mL of supernatants were transferred into a 2 mL brown injection bottle and run-on Agilent 6890 N GC (Agilent, USA).
-
bioRxiv - Microbiology 2024Quote: ... Cultures were grown at 30 °C in 96-well plates in an BioTek Epoch 2 shaking incubator (Agilent, Santa Clara, CA) for 72 hours.
-
bioRxiv - Cancer Biology 2024Quote: Sections from primary tumors and the matched axillary node with the largest metastatic focus (≥ 2 mm) were used for assessment of nerves (Neurofilament antibody, DAKO M0762), and angiogenesis markers (Factor-VIII ...
-
bioRxiv - Microbiology 2023Quote: Site-directed mutagenesis of SARS-CoV-2 spike was performed with the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent 200522), using primers listed in Supplementary table S2 and according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... was added to 2 mL of each of the sample supernatants before analysis by inductively coupled plasma-mass spectroscopy (ICP-MS, 7700x, Agilent Technologies) using an ASX-500 autosampler (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2024Quote: ... The glycolytic activity or glycoPER in response to Rotenone/Antimycin A and 2-deoxy-D-glucose was measured using glycolytic rate assay (Agilent, USA). All measurements were performed using Seahorse XFe96 Bioanalyzer (Agilent ...
-
bioRxiv - Bioengineering 2024Quote: ... Primary (FHL2 2 µg/mL and Ki67 2 µg/mL) and secondary antibodies (same as for in vitro immunofluorescence staining) were diluted in Dako antibody diluent (Dako, Germany). Washing steps were done in Dako washing buffer ...
-
bioRxiv - Immunology 2024Quote: BT-474-Luc2 cells (2 x 104 cells/well) were seeded in 96-well RTCA E-Plate (Agilent, Santa Clara, CA) and left to adhere for 24 hours ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The samples (2 µL) were resolved through an Agilent Poroshell 120 SB-C18 column (Agilent, 3.0 x 75 mm, 2.7 µm) maintained at 55°C at a flow rate of 0.40 mL/min with a multi-step gradient previously published using 0.1% formic acid in MilliQ water (mobile phase A ...
-
HNF4α isoforms regulate the circadian balance between carbohydrate and lipid metabolism in the liverbioRxiv - Genomics 2021Quote: ... Liver NE from WT and α7HMZ mice were prepared as previously described (Yuan et al., 2009).A custom-designed array was ordered from Agilent (SurePrint G3 Custom GE 4×180k), which contained oligonucleotides ∼60 nucleotides (nt ...
-
bioRxiv - Cell Biology 2019Quote: ... First peptides were fractionated using high pH reverse phase chromatography on a C18 column (150 × 2.1 mm i.d. - Kinetex EVO (5 μm, 100 Å)) on a HPLC system (Agilent, LC 1260 Infinity II, Agilent). A two-step gradient was applied ...
-
bioRxiv - Immunology 2021Quote: Gas chromatography was performed on an HP-5MS capillary column (5% benzene/95% methyl polysiloxane 30 m × 250 μm i.d., 0.25 μm film thickness, Agilent J & W Scientific, Folsom, CA, USA) with a constant flow of helium at 1 mL/min ...
-
bioRxiv - Neuroscience 2020Quote: ... Brain sections were washed with PBS-Tween 0,05 % (PBS-T) and blocked with a peroxidase enzyme blocker for 5 minutes (Dako Dual Endogenous Enzyme Block S2003) and goat serum (NGS ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 samples of myoepithelial cells and 5 samples of s-SHIP GFP+ cap cells were submitted and subjected to quality analysis using a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). All Samples had an average RNA integrity number (RIN ...
-
bioRxiv - Biophysics 2019Quote: The MBP-5-HT3A-ICD-pMALX soluble fusion proteins were overexpressed in Escherichia coli (E. coli) BL21-CodonPlus (DE3)-RIPL cells (Agilent Technologies; Santa Clara, CA). The cells were harvested by centrifugation (5,000 g for 15 min at 4°C ...
-
bioRxiv - Synthetic Biology 2020Quote: LC-MS analysis was performed with the ZORBAX SB-Aq StableBond Analytical column (5 μm, 4.6 × 250 mm, Agilent Teologies, Santa Clara, CA, USA) on an Agilent 1260/6460 Triple-Quadrupole LC/MS system (Santa Clara ...
-
bioRxiv - Immunology 2021Quote: ... TMT-labelled peptides were fractionated using high pH reverse phase chromatography on a C18 column (150 × 2.1 mm i.d. - Kinetex EVO (5 μm, 100 Å)) on a HPLC system (Agilent, LC 1260 Infinity II, Agilent). A two-step gradient was applied ...
-
bioRxiv - Physiology 2022Quote: ... The first was a DB 5 column (20 m long x 0.18 mm internal diameter x 0.18 μm thick) (Agilent J & W Scientific, Folsom, CA, USA), and the second a Rxi-17 column (0.84 m long x 0.1 mm internal diameter x 0.1 μm thick ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM calcium chloride for 15 min at room temperature prior to recording fluorescence on a Citation 5 microplate reader (Agilent-BioTek, Santa Clara, CA), exciting at 488 nm and measuring emission at 535 nm ...
-
bioRxiv - Bioengineering 2024Quote: ... The diameter of cells adhered to TCP was measured by the Cytation 5 cell imaging multimode reader measurement tool (Agilent Technologies, Santa Clara, CA). In-suspension measurements were determined using the T4 Auto Cellometer Bright Field Cell Counter (Nexelom Bioscience ...
-
bioRxiv - Microbiology 2023Quote: ... the GC-MS analysis was performed with An OPTIMA 5 MS Accent fused-silica capillary column on Agilent7890A/5975C GC-MS system (Agilent Technologies Inc., CA, USA), while the LC-MS analysis was performed on a ThermoFisher Ultimate 3000 UHPLC system with a Waters ACQUITY UPLC BEH C18 column (2.1mm × 100 mm ...
-
bioRxiv - Plant Biology 2023Quote: ... Aliquot of 5 μl of the eluate was injected into the LCMS system consisting of UHPLC 1290 Infinity II (Agilent, Santa Clara, CA, USA) coupled to 6495 Triple Quadrupole mass spectrometer (Agilent) ...
-
bioRxiv - Biochemistry 2022Quote: ... coupled with automated fraction collector in batches through a continuous gradient on an Agilent ZORBAX SB-C18 column (Agilent, 5 μm, 4.6 × 250 mm) at a column temperature of 40 °C to yield 45 fractions based on retention time and one fraction was collected per minute ...
-
bioRxiv - Cancer Biology 2024Quote: ... The analytes were separated on a Sciex C18 column (4.6 mm × 150 mm, 5 μm) maintained at 50°C using a 1260 Infinity HPLC instrument (Agilent Technologies, Santa Clara, CA, USA). A gradient flow of the mobile phase was applied ...
-
bioRxiv - Microbiology 2024Quote: Cell extracts were analyzed by injecting 5 µL into an Agilent 1290 Infinity II HPLC with an Agilent 6495C iFunnel QQQ mass spectrometer for detection (Agilent, Santa Clara, CA, USA). Separation of the analytes was achieved on an Agilent (Santa Clara ...
-
bioRxiv - Cancer Biology 2021Quote: ... the membranes were washed 3X with TBST followed by incubation with HRP-conjugated secondary antibodies (Rabbit Cytiva/Amersham NA934; Mouse Agilent/Dako P026002-2) for one hour at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: Immunofluorescence microscopy was performed on de-paraffinized tissue sections that received heat-induced antigen retrieval using Target Retrieval Solution (Agilent Dako, S169984-2). After washing and permeabilization in TBS-T universal buffer (0.2% Triton X-100 in tris-buffered saline) ...
-
bioRxiv - Cell Biology 2019Quote: ... Sections were then treated with Proteinase K (20 μg/mL) for 15 minutes for antigen retrieval and blocked with DAKO background reducing protein blocking agent (Agilent, X090930-2) prior to 1 hour incubation of CD206 (1:200 ...
-
bioRxiv - Biophysics 2021Quote: ... The cell suspension was then centrifuged at 8000 RPM for 2 minutes and the supernatant was collected and measured using a fluorescence spectrophotometer (Agilent Cary Eclipse). Using a similar measurement without the RBCs ...
-
bioRxiv - Neuroscience 2020Quote: CLC-2 mutants were generated by site-directed mutagenesis using a QuickChange XL Site-Directed Mutagenesis Kit (Agilent Technologies, Cedar Creek, TX). The following table lists primers used to generate expression vectors in this study.
-
bioRxiv - Neuroscience 2020Quote: ... the staining was revealed by 30 min incubation in a HRP-anti rabbit polymer system (DAKO REAL Envision™ Kit, #K400311-2, Agilent, France) followed by a DAB revelation of few seconds (DAKO DAB Kit ...
-
bioRxiv - Biochemistry 2021Quote: Plasmids encoding AlgE7 variants (Table 2) were constructed based on wild type AlgE7 (plasmid pBG27) (12) using the QuikChange™ Site-directed Mutagenesis Kit (Stratagene/Agilent) or Q5 site directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Cell Biology 2021Quote: ... FAMEs were re-dissolved in 2 ml pentane and chromatographed using a GC/MS instrument (SHIMADZU, QP2010 Ultra) with a DB-23 GC column (Agilent, 122-2332). FAME peaks were identified according to the fatty acid standards and integrated to calculate the TAG amount ...