Labshake search
Citations for Agilent :
4551 - 4600 of 8606 citations for Estriol ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
The antibiotic bedaquiline activates host macrophage innate immune resistance to bacterial infectionbioRxiv - Immunology 2019Quote: The oxygen consumption rate was measured using the XF Cell Mito Stress Test Kit (Seahorse, Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Variant enzymes were generated using the QuickChange Site-Directed Mutagenesis kit as per manufacturer’s instructions (Agilent technologies) and purified as for the wild-type proteins.
-
bioRxiv - Plant Biology 2019Quote: ... site-directed mutagenesis was conducted by QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA) and pPha21-oe was used as a template ...
-
bioRxiv - Genetics 2019Quote: ... The average size of all libraries was analysed using the 2100 Bioanalyzer High Sensitivity DNA Kit (Agilent) and the libraries concentration was measured by qPCR using SensiMix SYBR (Bioline ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Total RNA was analyzed for quality using the Bioanalyzer RNA 6000 Nano kit (Agilent, Santa Clara, CA) with RNA Integrity Numbers (RINs ...
-
bioRxiv - Microbiology 2020Quote: ... Two rounds of error-prone PCR were performed using the GeneMorph II Random Mutagenesis Kit (Agilent Technologies). The PCR product was cloned into the PADL22c vector and transformed via electroporation into the TG1 E ...
-
bioRxiv - Biochemistry 2019Quote: ... Seahorse XF base media without phenol red and Mito Stress Kits were from Agilent (Santa Clare, USA). All other chemicals including palmitate and 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide ...
-
bioRxiv - Developmental Biology 2020Quote: ... Mutagenesis of the putative Sp1 binding sites was performed using the QuikChange Site-Directed Mutagenesis Kit (Stratagene). All the reporter constructs were inserted and analyzed at the same landing attP site ...
-
bioRxiv - Cell Biology 2020Quote: ... and rotenone/antimycin A provided with the XF Cell Mito Stress Test Kit (#103015-100, Seahorse Bioscience) were prepared in XF assay medium (100840-000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mutagenesis was carried out with the QuikChange® Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) and confirmed by DNA sequencing.
-
bioRxiv - Immunology 2020Quote: ... The RNA quality was controlled using Agilent RNA 6000 Nano Kit (Agilent Technologies, Santa Clara, CA, USA) on an Agilent 2100 Bioanalyzer instrument (Agilent Technologies) ...
-
bioRxiv - Genetics 2021Quote: ... Two oligos (F: GCGATGCCACCTAGGGCAAGCTGACCCTG and R: CAGGGTCAGCTTGCCCTAGGTGGCATCGC) were used with the QuikChange II mutagenesis kit (Agilent, 200523). We confirmed that this mutation (GFPstop ...
-
bioRxiv - Genomics 2021Quote: ... The WES libraries were prepared using the SureSelect capture V5+UTR kit (Agilent, Santa Clara, CA, USA) and sequenced with 100bp paired-end sequencing on a HiSeq 2500/4000 (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... All site-directed mutagenesis (SDM) reactions were carried out using the QuikChange Lightning SDM Kit (Agilent, USA). The mutations were verified by sequencing (Eurofins Genomics ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNase-treated gDNA was used to construct sequencing libraries using the Agilent SureSelectXT Reagent Kit (Agilent Technologies). Libraries were prepared for capture with 6 cycles of PCR amplification ...
-
bioRxiv - Microbiology 2021Quote: ... Denaturing gel electrophoresis and finally using DNA/RNA 1000 chip kit in a Bioanalyzer 2100 (Agilent Technologies) and quantified by Quant-iT™ RiboGreen® Assay kit (Life Technologies).
-
bioRxiv - Pathology 2020Quote: ... Site-directed mutagenesis was performed with the QuikChange® II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and primers were designed using the QuikChange Primer Design tool (Agilent Technologies).
-
bioRxiv - Plant Biology 2021Quote: ... RNA was extracted from the leaf tissue using the Plant RNA Isolation Mini Kit Protocol (Agilent Technologies). RNA quality and concentration was measured using a NanoDropTM Lite Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: Viral mutants were generated by site-directed mutagenesis using the Quikchange II Site-directed mutagenesis kit (Agilent) with forward and reverse primers specific for each mutation (Key Resources Table) ...
-
bioRxiv - Genetics 2019Quote: ... The catalytically inactive point mutation C265S43 was introduced using the QuikChange II site-directed mutagenesis kit (Agilent) to create T7-DNMT3B2 catalytic dead (CD) ...
-
bioRxiv - Microbiology 2019Quote: ... point mutants were generated using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... XPRT variants were created using the QuikChange Site-directed mutagenesis kit according to the manufacturer’s protocol (Agilent). Mutations were confirmed by DNA sequencing ...
-
bioRxiv - Genomics 2020Quote: ... RNA integrity was assesses using Agilent Bioanalyzer using RNA 6000 pico kit (Agilent Technologies cat # 5067-1513).
-
bioRxiv - Biochemistry 2020Quote: Mutagenesis reactions were completed using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). We used a previously-cloned His-tagged human NTCP in the pcDNA5/FRT vector for the mutagenesis template (Zhao et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... The quality and the quantity of RNA was confirmed with a Bioanalyzer (Agilent, RNA 6000 Nano Kit) and Qubit 2.0 fluorometer (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2019Quote: ... Integrity of total RNA was assessed with the Agilent RNA 6000 Nano kit (Agilent Technologies, Waldbronn, Germany) on a Bioanalyzer 2100 (Agilent Technologies ...
-
bioRxiv - Genomics 2021Quote: ... we performed quality control of each library using Agilent 2100 bioanalyzer with the DNA 1000 Kit (Agilent). Libraries were sequenced in single-reads with read lengths of 50 nucleotides in Illumina HiSeq2500 sequencers at the Genomics Unit of the CRG.
-
bioRxiv - Bioengineering 2020Quote: ... The RNA integrity was assessed using an RNA 6000 Pico Kit for Bioanalyzer (Agilent Technologies #5067-1513). The RNA-seq libraries were constructed using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB #E7770 ...
-
bioRxiv - Genetics 2019Quote: ... These SNPs were made using the Quik Change II XL Site-Directed Mutagenesis Kit (Agilent Technology, 200521). The gRNA and c(3)GccΔ1 homologous repair template plasmid were sent to Genetivision (Houston ...
-
Gatekeeper helix activates Golgi SM protein Sly1 and directly mediates close-range vesicle tetheringbioRxiv - Cell Biology 2020Quote: ... a library of SLY1* mutant alleles was constructed using the GeneMorph II Random Mutagenesis Kit (Agilent #200550). The SLY1 open reading frame was amplified using the “medium mutation rate” PCR protocol ...
-
bioRxiv - Cell Biology 2019Quote: Generation of pGDB-SDEL plasmid was done using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) on the pGDB plasmid with primers P1 and P2 per the manufacturer’s protocol36.
-
bioRxiv - Evolutionary Biology 2019Quote: ... RNA integrity was assessed using Agilent RNA 6000 Nano kit and 2100 Bioanalyzer instrument (both Agilent Technologies). All samples had RIN values above 8.
-
bioRxiv - Cell Biology 2019Quote: ... was hybridized with 1.65 μg Cy3-labeled cRNA using a gene expression hybridization kit (Agilent Technologies, Inc.). After 17 h of hybridization ...
-
bioRxiv - Biophysics 2019Quote: ... Point mutations were made using Quickchange II XL Site-Directed Mutagenesis kit (Agilent technologies, Santa Clara, CA). The sequences of the DNA constructs were confirmed by fluorescence-based DNA sequencing (Genewiz LLC ...
-
bioRxiv - Developmental Biology 2019Quote: ... and the RNA Nano 6000 Assay Kit of the Agilent Bioanalyzer 2100 system (Agilent Technologies, CA, USA). The isolated RNA pellets were stored at −80°C until needed ...
-
bioRxiv - Genomics 2021Quote: ... and DNA fragment length assays (HS-50 kb fragment kit from AATI, now part of Agilent Inc.). The PacBio library was prepared using the Pacific Biosciences Express library preparation protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... All E protein variants were obtained by site-directed mutagenesis using QuikChange kit (Stratagene, La Jolla, California) and were confirmed by sequencing the plasmid DNA at Macrogen Company (Seoul ...
-
bioRxiv - Microbiology 2021Quote: ... RNA integrity was controlled on a Fragment Analyzer using the High Sensitivity RNA Analysis Kit (Agilent, USA). cDNA libraries were constructed and sequenced as a service provided by vertis Biotechnologie AG (Germany ...
-
bioRxiv - Neuroscience 2021Quote: ... The integrity of the RNA was assessed using the RNA 6000 Pico Kit (5067-1513, Agilent Technologies) on a 2100 Bioanalyzer (Agilent Technologies Inc. ...
-
bioRxiv - Genomics 2021Quote: ... Fragment size distribution was assessed using the High Sensitivity DNA kit on the Bioanalyzer (Agilent Technologies, USA). Three libraries were created using the Hackflex protocol described above ...
-
bioRxiv - Microbiology 2021Quote: ADAP1 and KRAS point mutants were generated using QuikChange II XL Site-Directed Mutagenesis kit (Agilent, 200522) per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... All mutant genes were constructed by polymerase chain reactions using a QuickChange Site-Directed Mutagenesis kit (Stratagene) and primers (Table S1) ...
-
bioRxiv - Biochemistry 2021Quote: Arpin WT and mutants W195D and I199D/M200D were obtained using the QuikChange Lightning mutagenesis kit (Agilent). Full length ORFs encoding Arpin WT and mutants W195D and I199D/M200D were cloned in our custom-made plasmid (MXS EF1Flag Blue2 SV40pA PGK Blasti bGHpA ...
-
Enhancer Remodeling Promotes Tumor-Initiating Activity in NRF2-Activated Non-Small Cell Lung CancersbioRxiv - Cancer Biology 2020Quote: ... cDNA sequencing libraries were then prepared using the SureSelect Strand-Specific RNA library preparation kit (Agilent Technologies) with a modified protocol omitting the polyA selection step ...
-
bioRxiv - Genomics 2021Quote: ... Quality and quantity of libraries were checked using HS gDNA 50 kb kit on fragment analyzer (Agilent) and dsDNA Qubit assay (Thermofisher) ...
-
bioRxiv - Physiology 2021Quote: ... The amount of RNA was quantified with the Agilent RNA 6000 Nano Kit (Agilent Technologies, #5067-1511). RNA-sequencing libraries were prepared from mouse liver total RNA using the Illumina TruSeq Stranded Total RNA sample preparation protocol following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2020Quote: ... and its fragmentation pattern was obtained via Agilent 2100 Bioanalyzer (Agilent, High Sensitivity DNA kit, 5067-4626). Extracted cfDNA was stored at −80° C.
-
bioRxiv - Cell Biology 2020Quote: ... All lines were tested monthly and verified as being mycoplasma-free (MycoSensor PCR Assay Kit, Agilent Technologies).
-
bioRxiv - Cell Biology 2020Quote: ... Cellular respiratory capacity was assayed using the XF Cell Mito Stress Test Kit (Agilent Technologies, Inc., USA). The assay consists of repeated cycles of 3-min mix ...
-
Comparative regulomics reveals pervasive selection on gene dosage following whole genome duplicationbioRxiv - Evolutionary Biology 2020Quote: ... Library mean length was determined by running on a 2100 Bioanalyzer using the DNA 1000 Kit (Agilent) and library concentration was determined with the Qbit BR Kit (Thermo Scientific) ...