Labshake search
Citations for Agilent :
4451 - 4500 of 7040 citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA and library preparations were assessed using the Bioanalyzer High-Sensitivity DNA Kit (Agilent, 5067-4627). Samples were pooled to equimolar concentrations and the pool sequenced across 24 lanes of an Illumina HiSeq 4000 according to the standard 10X Genomics protocol ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 1 μg total RNA template per reaction was used using High Capacity cDNA Reverse Transcription Kit (Agilent). RNAase-free water (total 4.2 μl) ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA quality was confirmed as RIN 3 7.5 via Bioanalyzer RNA 6000 Pico kit (Agilent, 5067-1514) and RNA was quantified via Qubit RNA HS Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA and library preparations were assessed using the Bioanalyzer High-Sensitivity DNA Kit (Agilent, 5067-4627). Samples were pooled to equimolar concentrations and the pool sequenced across 24 lanes of an Illumina HiSeq 4000 according to the standard 10X Genomics protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... then converted to cDNA using AffinityScript cDNA synthesis kit according to manufacturer’s instructions (Agilent Technologies, CA, USA). Commercially available gene-specific TaqMan probes for Ager (Mm 01134790_g1) ...
-
bioRxiv - Immunology 2021Quote: ... RNA quality was assessed using the Agilent 2100 Bioanalyzer and RNA Nano Chip kit (Agilent Technologies, CA). RNA-seq libraries were generated using TruSeq Stranded Total RNA with Ribo-Zero Globin Complete kit (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... libraries were prepared using the Illumina TruSeq stranded mRNA kit and validated on the Bioanalyzer 2100 (Agilent). Samples were sequenced using the Illumina HiSeq 2000 ...
-
bioRxiv - Neuroscience 2022Quote: ... The N100A zDHHC/A17 mutants were generated by our laboratory by site-directed mutagenesis using primers designed by Agilent QuickChange II XL primer design software and using QuickChange II XL site-directed mutagenesis kit (Agilent Technologies), and confirmed by DNA sequencing through Eurofins Genomics (Louisville ...
-
bioRxiv - Genetics 2022Quote: ... and antimycin/rotenone (1 mmol/L and 1 mmol/L) (Cell Mito Stress Test Kit, Agilent, #103015100). Analysis was carried out by using the Seahorse analyzer software.
-
bioRxiv - Genomics 2022Quote: ... and an Agilent 2100 Bioanalyzer using an RNA 6000 Nano LabChip kit (Agilent Technologies Ltd., Cork, Ireland), according to the manufacturers’ instructions ...
-
bioRxiv - Pathology 2022Quote: ... The libraries were quantified using the Agilent 2100 Bioanalyzer System with a High Sensitivity DNA Kit (Agilent) according to the manufacture’s instruction ...
-
bioRxiv - Neuroscience 2022Quote: ... The quality of the generated libraries was monitored by using the High Sensitivity DNA Analysis Kit (Agilent) and the Bioanalyzer 2100 ...
-
bioRxiv - Genomics 2022Quote: Lung total RNA quality and quantity were examined using a Bioanalyzer (Agilent 2100, RNA 6000 nano kit). Sequencing libraries were constructed using a TruSeq Stranded Total RNA Library Prep Gold kit (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... The quality of RNA isolated was checked using Bioanalyzer RNA 6000 Nano kit (Agilent, Santa Clara, CA). For RNA seq ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell pellets were lysed and RNA was isolated using the Absolutely RNA Microprep Kit (400805, Agilent Technologies), Absolutely RNA Nanoprep Kit (400753 ...
-
bioRxiv - Immunology 2022Quote: ... and an Advanced Analytical Fragment Analyzer System using a Fragment Analyzer NGS Fragment Kit (Agilent, DNF-473), respectively ...
-
bioRxiv - Immunology 2022Quote: ... and Bioanalyser-2100 equipped with an RNA 6000 Nano Kit (5067-1511; Agilent Technologies, Santa Clara, CA). cDNA was synthesized using iScript Kit (1708891 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the quality of the RNA samples checked on an Agilent Bioanalyzer (Agilent; RNA 6,000 Nano kit).
-
bioRxiv - Neuroscience 2022Quote: RNA integrity was analyzed on an Agilent 2100 Bioanalyzer using RNA 6000 Nano kit (Agilent, 5067-1511). Only samples with an RNA integrity number (RIN ...
-
bioRxiv - Biophysics 2022Quote: ... constructs were generated by site-directed mutagenesis based on enNTS1ΔM4 (M2044.60/M2084.64/M2445.45/M2505.51/M3306.57/M3527.36) using the Lightning site-directed mutagenesis kit (Agilent, Santa Clara, CA) and the forward and reverse primers CACTACTTCTACCTGCTGTCTAACGCGCTGG and CCAGCGCGTTAGACAGCAGGTAGAAGTAGTG ...
-
bioRxiv - Cancer Biology 2022Quote: ... Library QC was assessed using an Agilent Technologies Bioanalyzer High Sensitivity kit (Agilent Technologies, Cat#5067-4626).
-
bioRxiv - Molecular Biology 2019Quote: CbAgo double mutant (D541A, D611A) was generated using an adapted Quick Directed Mutagenesis Kit instruction manual (Stratagene). The primers were designed using the web-based program primerX (http://bioinformatics.org/primerx).
-
bioRxiv - Genetics 2019Quote: ... the C583Y mutation was introduced into the slc12a7a/kcc4a pXT7 construct using a QuikChange II Kit (Agilent) as per the manufacturer’s protocol.
-
bioRxiv - Microbiology 2019Quote: ... and RNA quality was assessed using an Agilent 2100 Bioanalyzer and an RNA 6000 Nano kit (Agilent) to confirm integrity ...
-
bioRxiv - Molecular Biology 2019Quote: ... Radioactive probes were synthesized using a Prime-It II Random Primer Labeling Kit (300385, Agilent Technologies, Inc).
-
The antibiotic bedaquiline activates host macrophage innate immune resistance to bacterial infectionbioRxiv - Immunology 2019Quote: The oxygen consumption rate was measured using the XF Cell Mito Stress Test Kit (Seahorse, Agilent Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Variant enzymes were generated using the QuickChange Site-Directed Mutagenesis kit as per manufacturer’s instructions (Agilent technologies) and purified as for the wild-type proteins.
-
bioRxiv - Plant Biology 2019Quote: ... site-directed mutagenesis was conducted by QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, USA) and pPha21-oe was used as a template ...
-
bioRxiv - Genetics 2019Quote: ... The average size of all libraries was analysed using the 2100 Bioanalyzer High Sensitivity DNA Kit (Agilent) and the libraries concentration was measured by qPCR using SensiMix SYBR (Bioline ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Total RNA was analyzed for quality using the Bioanalyzer RNA 6000 Nano kit (Agilent, Santa Clara, CA) with RNA Integrity Numbers (RINs ...
-
bioRxiv - Biochemistry 2019Quote: ... Seahorse XF base media without phenol red and Mito Stress Kits were from Agilent (Santa Clare, USA). All other chemicals including palmitate and 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide ...
-
bioRxiv - Developmental Biology 2020Quote: ... Mutagenesis of the putative Sp1 binding sites was performed using the QuikChange Site-Directed Mutagenesis Kit (Stratagene). All the reporter constructs were inserted and analyzed at the same landing attP site ...
-
bioRxiv - Cell Biology 2020Quote: ... and rotenone/antimycin A provided with the XF Cell Mito Stress Test Kit (#103015-100, Seahorse Bioscience) were prepared in XF assay medium (100840-000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mutagenesis was carried out with the QuikChange® Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) and confirmed by DNA sequencing.
-
bioRxiv - Immunology 2020Quote: ... The RNA quality was controlled using Agilent RNA 6000 Nano Kit (Agilent Technologies, Santa Clara, CA, USA) on an Agilent 2100 Bioanalyzer instrument (Agilent Technologies) ...
-
bioRxiv - Genetics 2021Quote: ... Two oligos (F: GCGATGCCACCTAGGGCAAGCTGACCCTG and R: CAGGGTCAGCTTGCCCTAGGTGGCATCGC) were used with the QuikChange II mutagenesis kit (Agilent, 200523). We confirmed that this mutation (GFPstop ...
-
bioRxiv - Genomics 2021Quote: ... The WES libraries were prepared using the SureSelect capture V5+UTR kit (Agilent, Santa Clara, CA, USA) and sequenced with 100bp paired-end sequencing on a HiSeq 2500/4000 (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... All site-directed mutagenesis (SDM) reactions were carried out using the QuikChange Lightning SDM Kit (Agilent, USA). The mutations were verified by sequencing (Eurofins Genomics ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNase-treated gDNA was used to construct sequencing libraries using the Agilent SureSelectXT Reagent Kit (Agilent Technologies). Libraries were prepared for capture with 6 cycles of PCR amplification ...
-
bioRxiv - Microbiology 2021Quote: ... Denaturing gel electrophoresis and finally using DNA/RNA 1000 chip kit in a Bioanalyzer 2100 (Agilent Technologies) and quantified by Quant-iT™ RiboGreen® Assay kit (Life Technologies).
-
bioRxiv - Pathology 2020Quote: ... Site-directed mutagenesis was performed with the QuikChange® II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and primers were designed using the QuikChange Primer Design tool (Agilent Technologies).
-
bioRxiv - Plant Biology 2021Quote: ... RNA was extracted from the leaf tissue using the Plant RNA Isolation Mini Kit Protocol (Agilent Technologies). RNA quality and concentration was measured using a NanoDropTM Lite Spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: Viral mutants were generated by site-directed mutagenesis using the Quikchange II Site-directed mutagenesis kit (Agilent) with forward and reverse primers specific for each mutation (Key Resources Table) ...
-
bioRxiv - Genetics 2019Quote: ... The catalytically inactive point mutation C265S43 was introduced using the QuikChange II site-directed mutagenesis kit (Agilent) to create T7-DNMT3B2 catalytic dead (CD) ...
-
bioRxiv - Microbiology 2019Quote: ... point mutants were generated using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... XPRT variants were created using the QuikChange Site-directed mutagenesis kit according to the manufacturer’s protocol (Agilent). Mutations were confirmed by DNA sequencing ...
-
bioRxiv - Genomics 2020Quote: ... RNA integrity was assesses using Agilent Bioanalyzer using RNA 6000 pico kit (Agilent Technologies cat # 5067-1513).
-
bioRxiv - Biochemistry 2020Quote: Mutagenesis reactions were completed using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). We used a previously-cloned His-tagged human NTCP in the pcDNA5/FRT vector for the mutagenesis template (Zhao et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... The quality and the quantity of RNA was confirmed with a Bioanalyzer (Agilent, RNA 6000 Nano Kit) and Qubit 2.0 fluorometer (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2019Quote: ... Integrity of total RNA was assessed with the Agilent RNA 6000 Nano kit (Agilent Technologies, Waldbronn, Germany) on a Bioanalyzer 2100 (Agilent Technologies ...