Labshake search
Citations for Agilent :
401 - 450 of 3985 citations for 7 chloro 1 5 naphthyridin 2 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 mM L-glutamine (Agilent) and the cells were placed in a non-CO2 incubator set at 37°C for approximately 1 h before starting the assay ...
-
bioRxiv - Cancer Biology 2024Quote: ... Serum-Free (Agilent Dako, X090930-2) for 10 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... Serum-Free (Agilent Dako, X090930-2) for 10 minutes ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 mM XF Glutamine (Agilent), and then cells were incubated in a CO2-free incubator for 1 hr ...
-
bioRxiv - Immunology 2024Quote: ... 2 mM glutamine (Agilent, 103579-100), 10 mM glucose (Agilent ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Blots were washed clear of unbound antibody in TBS-T before addition of anti-rabbit-HRP secondary antibody (1:1000 in 5% milk/TBS-T; Agilent Technologies, CA, U.S.A.) for 1 hr at RT ...
-
bioRxiv - Immunology 2022Quote: ... Quality control of the libraries to ensure no adapter dimers were present was carried out by examining 1ul of a 1:5 dilution on a High Sensitivity DNA chip (Agilent Technologies: 5067-4626) on an Agilent 2100 Bioanalyzer ...
-
bioRxiv - Physiology 2021Quote: All samples with the QC and 7 high-pH fractions were acquired using an UHPLC 1290 system (Agilent Technologies; Santa Clara, USA) coupled on-line to an Q Exactive HF mass spectrometer (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... they were first permeabilized using an acetone freeze step for 7 min at -20° C before staining with guinea-pig anti-insulin (Dako, Carpinteria, CA), Alexa Fluor 488 or 647 goat anti-guinea-pig (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2019Quote: An FT-ICR-MS (7 Tesla, SolariXR, Bruker, Bremen, Germany) was used in the flow-injection mode (a HPLC 1260 Infinity from Agilent (Waldbronn, Germany) was used) ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA samples typically yielded >100ng of RNA with a RIN value of > 7 as determined by Bioanalyzer (Agilent Technologies, Santa Clara, USA).
-
bioRxiv - Biochemistry 2023Quote: ... the proteins were loaded in a Shodex PH-814a hydrophobic interaction chromatography column and eluted with a (NH4)2SO4 gradient in Hepes 25 mM pH 7 on a HPLC system (Agilent 1200, USA). The recovered fractions were separated by SDS-PAGE on 12% gels ...
-
bioRxiv - Systems Biology 2023Quote: ... cDNA was amplified by 7 cycles and the total yield of cDNA was assessed on High Sensitivity DNA Assay (Agilent 2100 Bioanalyzer) resulting on average in 168 ng ...
-
bioRxiv - Systems Biology 2023Quote: ... 7 cycles were used for the Sample Index PCR reaction and final libraries were evaluated using D5000 ScreenTape (Agilent 4200 TapeStation System) and DNA 7500 (Agilent 2100 Bioanalyzer) ...
-
bioRxiv - Systems Biology 2020Quote: ... lyophilized samples were resuspended in Buffer A (5 mM NH4HCO2/ 2% ACN) and 5 mg peptide material (5 mg/ml) was loaded onto a reversed phase column (ZORBAX 300Extend-C18, Agilent). Peptides were separate at a flow rate of 2 ml/min and a constant column temperature of 40 °C using a binary buffer system ...
-
bioRxiv - Biochemistry 2020Quote: ... 50 Pulsed-splitless injection was used to inject 5 μL samples onto an HP-5ms (5%-phenyl)-methylpolysiloxane capillary GC column (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2019Quote: ... Size exclusion chromatography-inductively coupled plasma-mass spectrometry was performed using an Agilent Technologies 1100 Series liquid chromatography system with a BioSEC 5 SEC column (5 μm particle size, 300 Å pore size, I.D. 4.6 mm, Agilent Technologies) and 7700x Series ICP-MS as previously described50 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Biochemistry 2022Quote: ... SEC profiles for the KWOCAS (Figures 2,3,5 and Supplementary Figure S7) were obtained by high pressure liquid chromatography on an Agilent Bio SEC-5 column (Agilent) at a flow rate of 0.35 mL/min by injection of 10 μL of purified eluate using a mobile phase of Tris-buffered saline (50 mM Tris pH 8 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Secondary antibodies (HRP linked) were swine anti–rabbit (P039901-2) and goat anti–mouse (P044701-2) (DAKO). Imaging was done using SuperSignal West Femto (ThermoFisher ...
-
bioRxiv - Plant Biology 2020Quote: ... Mega BE-C18 (5 g, 20 ml; Agilent), was conditioned with 100 ml of 100% methanol and equilibrated with 50 ml of deionized water ...
-
bioRxiv - Neuroscience 2020Quote: ... with the 5×SRE-Luc reporter plasmid (Stratagene) and EF1αLacZ (β-galactosidase [β-Gal]) ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA Integrity Number (RIN) ≥5 (2100 Bioanalyzer, Agilent), and in the AD group ...
-
bioRxiv - Physiology 2022Quote: ... 5 μm column (Agilent p/n 993967-902). For the HPLC ...
-
bioRxiv - Cancer Biology 2023Quote: ... A BioTek Cytation 5 (Agilent, Santa Clara, CA) was used to take representative images ...
-
bioRxiv - Immunology 2024Quote: ... and 5 µM InfinityLab deactivator additive (Agilent Technologies).
-
bioRxiv - Immunology 2021Quote: ... and bound serum IgG was detected by 70 µL/well of 1:3000 diluted rabbit anti-human IgG antibody linked to horseradish peroxidase (Agilent, P021402-2) incubated for 2h at RT ...
-
bioRxiv - Developmental Biology 2019Quote: ... and incubated for 2 hours at room temperature with a biotinylated goat anti-rabbit secondary antibody (Dako, 1:500 in blocking solution). Cells were washed 3 times and incubated for 30 minutes with streptavidin Cy3 (Sigma ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by overnight staining with 1:300 dilutions of rat-anti-C-peptide (DSHB; GN-ID4-S) and mouse-anti-CD31 (Dako; M082329-2) primary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... the co-cultures were incubated first with primary antibody for glial fibrillary acidic protein (GFAP, 1:400, Z033429-2, Dako, Glostrup, Denmark) prepared in 5% NGS in DPBS overnight at +4 following an incubation with Alexa Fluor405 (A31556 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and incubated for 30 minutes at room temperature with the secondary antibody (Supplementary Table 2)(1:500 diluted in DAKO Antibody Diluent). Cells were washed with 0.2% Triton X-100 in PBS ...
-
bioRxiv - Microbiology 2021Quote: ... were designed based on the DNA sequence for SARS-CoV-2 Wuhan-Hu-1 using the QuickChange Primer Design tool (Agilent Technologies, Inc.). Mutagenesis was carried out on a pCDNA-SARs2 Wuhan-Hu 1 S plasmid to create the P681H mutation ...
-
bioRxiv - Microbiology 2020Quote: ... Primary antibody solution was then washed out 3x with TBS-T and TBS-T + 5% NFDM + 1:2000 Dako goat anti-rabbit or anti-mouse HRP-conjugated immunoglobulins (Agilent, Santa Clara, CA, USA) was added ...
-
bioRxiv - Biochemistry 2021Quote: ... protein samples were diluted to a final concentration of 5 µM with solvent A and then desalted on a reverse phase-C8 cartridge (Zorbax 300SB-C8, 5 µm, 300 µm ID 5 mm, Agilent Technologies) at a flow rate of 50 μl/min for 3 min with 100 % solvent A and subsequently eluted with 70 % solvent B for MS detection ...
-
bioRxiv - Immunology 2019Quote: ... single fractions were loaded onto a trap column (Zorbax 300SB-C18 5 µm, 5 × 0.3 mm, Agilent Biotechnologies, Palo Alto, CA) with a binary pump at a flow rate of 45 µL/min ...
-
bioRxiv - Systems Biology 2020Quote: ... 1 μl of each sample containing 2 μg of total native peptides and 100 fmol of each standard peptide was loaded on a precolumn Zorbax 300SB-C18 (5 μm, 5 × 0.3 mm) (Agilent Technologies, USA) and washed with 5 % acetonitrile for 5 min at a flow rate of 10 μl/minute before analytical LC separation ...
-
bioRxiv - Microbiology 2020Quote: ... n-dodecane samples were subjected to the Agilent 6890N gas chromatograph equipped with a (5%-phenyl)-methylpolysiloxane HP-5 column (length, 30 m; inside diameter, 0.32 mm; film thickness, 0.25 mm; Agilent Technologies, Ratingen, Germany) and a flame ionization detector (FID) ...
-
bioRxiv - Microbiology 2022Quote: The supernatant and extract fractions were dissolved in 0.1% TFA solution in deionized water and applied to Agilent Prep 5 C18 column (10 x 250 mm, particle size 5 μm, Agilent Technologies). The processed McCYps and McCEco were first purified in 0.1% TFA/acetonitrile system in a linear 1-13% gradient of acetonitrile ...
-
bioRxiv - Microbiology 2022Quote: ... resuspended in 0.1% TFA in MQ and applied to Agilent 5 Prep-C18 RP-HPLC column (250 x 10 mm, particle size 5 μM, Agilent Technologies). The purification of Asp-pNA was carried out in a linear 5-25% gradient of acetonitrile ...
-
bioRxiv - Molecular Biology 2023Quote: ... together with Agilent Bio SEC-5 guard column (2000 Å, 7.8 × 50 mm, 5 µm particles) was connected to the Agilent 1200 HPLC system (Agilent Technologies) and equilibrated with 2 column volumes (CV ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μL of sample was injected in a reverse phase column (Agilent PLRP-S 2.1 x 50 mm 100A 5 μm) held at 60 °C and eluted with a water-to-acetonitrile gradient from 95% to 50% water ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA samples yielded >280ng of RNA (>5.6ng/µl in a total eluate of 50µl) with a RIN value of generally > 7 as determined by Bioanalyzer (Agilent Technologies, Santa Clara, USA).
-
bioRxiv - Neuroscience 2019Quote: The monkeys were scanned on an actively shielded 7-Tesla 68-cm horizontal bore scanner with a DirectDrive console (Agilent, Santa Clara, California) with a Siemens AC84 gradient subsystem (Erlangen ...
-
bioRxiv - Cell Biology 2020Quote: ... and Nup133-mEGFP(-7) were cloned from the repair template plasmids constructed above via the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, Santa Clara, CA). For each CRISPR cell line ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quality of the RNA samples (RIN score >7) was verified on the Agilent 2100 Bioanalyzer using the RNA 6000 kit (Agilent, cat# 5067-1513). 1 µg of each RNA sample was then used for poly(A ...
-
bioRxiv - Immunology 2023Quote: ... Rabbit anti-goat IgG (P044901-2) or goat anti-rabbit IgG (P044801-2) secondary antibodies were from Agilent.
-
bioRxiv - Cell Biology 2019Quote: ... and treated with 2% proteinase K (Dako) in Tris-HCl buffer solution (pH 7.5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 2 mM glutamine (Seahorse®, Agilent) in a CO2 free incubator for 1 hour ...