Labshake search
Citations for Agilent :
401 - 450 of 4153 citations for 6 Chloroimidazo 1 2 b pyridazine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: Peak integration and quantification were performed using MassHunter Workstation Quantitative Analysis software (version B.07.00, Agilent). Specific high-abundance ions from total ion chromatograms were chosen to calculate each fatty acid peak.
-
bioRxiv - Plant Biology 2023Quote: ... The data were processed in MassHunter Quantitative B.09.00 software (Agilent Technologies, Santa Clara, CA, USA) (Agilent Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... Peak calls and abundance calculations were obtained with MassHunter Workstation Software Version B.06.00 SP01/Build 6.0.388.1 (Agilent). Final concentrations were calculated from a standard curve for each sphingolipid run in parallel.
-
bioRxiv - Genetics 2023Quote: ... quantification and identification were all carried out with Quantitative Analysis MassHunter Workstation Software (Version B.09.00 / Build 9.0.647.0, Agilent Technologies ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The demultiplexing data files (.DeMP.d) were recalibrated using IM–MS Reprocessor (Version B.08.00, Agilent Technologies). The reference masses used for mass calibration were m/z 112.985587 and 1033.988109 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and natural isotope abundance correction were performed by the Agilent Profinder B.10.00 Software (Agilent Technologies).
-
bioRxiv - Microbiology 2023Quote: ... Mass spectra were extracted with MassHunter Qualitative Analysis Software V B.06.00 Build 6.0.633.0 (Agilent Technologies). The obtained mass spectra were transformed to netCDF files and imported into MZmine V2.20 (Copyright 2005−2012 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Data analysis and integration of the chromatographic peaks was undertaken in MassHunter (B 10.1, Agilent Technologies) software.
-
bioRxiv - Biochemistry 2023Quote: ... B: 98% acetonitrile/0.1% FA in water) (1290 Infinity II LC system, Agilent Technologies, Waldbronn, Germany). The temperature within the customized LC system was kept at 0 °C to minimize the back exchange ...
-
bioRxiv - Microbiology 2023Quote: Culture supernatant data analyses were performed using MassHunter Quantitative Analysis software (version B.10, Agilent Technologies). Metabolite identifications were confirmed by matching to authentic standard spectra and retention time and spectra in the NIST Tandem Mass Spectral Library Version 2.3 (see Supplementary Tables 12 & 13 for background and validation methods of each metabolite) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Data were processed using MassHunter Quantitative Analysis (for QqQ, version B.07.01/Build 7.1.524.0, Agilent Technologies). Signal intensity drift correction was performed on the pooled QC samples and metabolites with CV > 30% were discarded (Dunn ...
-
bioRxiv - Plant Biology 2023Quote: ... Matrix Science) and confirmed with Spectrum Mill MS Proteomics Workbench (Rev B.06.00.201, Agilent Technologies, Inc.). Search parameters included modifications carboxymethylation and oxidation of methionine ...
-
bioRxiv - Molecular Biology 2024Quote: ... The data were further analyzed with MassHunter Qualitative Analysis Navigator B.08.00 (Agilent Technologies, CA, USA) and LIMSA software67.
-
bioRxiv - Plant Biology 2020Quote: The contents of celastrol and wilforic acid A were analyzed by Agilent 1260LC-6400 QQQ (triple quadrupole mass) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using a telomere PNA (peptide nucleic acid) FISH Kit/FITC (DAKO, Denmark) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... Fatty acid methyl esters were detected by GC-MS (Agilent 5977A-7890B) according to the method described in Ramakrishnan et al ...
-
bioRxiv - Immunology 2021Quote: ... The Long-Chain Fatty Acid Substrate Oxidation kit (Agilent cat #103672-100) was utilized to probe differences in OCR upon injection with either vehicle (media only ...
-
bioRxiv - Cancer Biology 2022Quote: ... The matrix employed was α-cyanohydroxycinnamic acid obtained in solution from Agilent Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... Resin acid identification and quantification were performed by capillary GC (Agilent 7890A). Helium ...
-
bioRxiv - Microbiology 2023Quote: ... Amino acid analysis was performed by high-pressure liquid chromatography (HPLC) (Agilent 1100 ...
-
bioRxiv - Biophysics 2022Quote: ... Amino acid analysis was performed on an Agilent 1260 HPLC (Agilent Technologies) equipped with a fluorescence detector using automated o-phtalaldehyde/2-mercaptopropionic acid (OPA/MPA ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sure 2 (Agilent) competent cells were transformed with the ligation product and cultured at reduced temperatures (27°C) ...
-
bioRxiv - Bioengineering 2019Quote: ... The microtissues were then washed in PBS (3 × 1 hour) before mounting on glass slides using fluoro-safe mounting media (Dako, S3023). Mounted samples were allowed to cure for 1 day and then imaged using a confocal microscope (Zeiss LSM700 Confocal Microscope).
-
bioRxiv - Neuroscience 2021Quote: ... DNA was labeled with Hoechst (1:2000) for 3 min and the sections were mounted using fluorescence mounting media (Dako, S3023). All images were taken using a Zeiss Observer Z1 fluorescent microscope using a 10X objective ...
-
bioRxiv - Systems Biology 2023Quote: ... Tissues next underwent antigen retrieval was carried out by submerging sides in 3-in-1 Target Retrieval Solution (pH 9, DAKO Agilent) and incubating them at 97°C for 40 minutes in a Lab Vision PT Module (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Organoids were incubated in the following primary antibodies for 3 h at 24L: gastrin (1:1000, Cat #A0568, A0568, AB_2757270, Dako Agilent Technologies), Chromogranin A (1:100 ...
-
bioRxiv - Molecular Biology 2020Quote: ... membranes were incubated with rabbit anti-mouse horseradish peroxidase (HRP) conjugated antibody (P026002-2, Dako, 1:1000) as secondary antibody at RT for 1 h ...
-
bioRxiv - Bioengineering 2019Quote: ... Hydrogels were incubated in a 1:100 dilution mouse anti-human CD31 primary antibody (Agilent IS61030-2) overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-CD3 antibody at a dilution of 1:200 (A045229-2, Dako Agilent Pathology Solutions), rat monoclonal anti-CD45 antibody at a dilution of 1:100 (05-1416 ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit polyclonal anti-CD3 antibody at a dilution of 1:200 (A045229-2, Dako Agilent Pathology Solutions), rat monoclonal anti-CD45 antibody at a dilution of 1:100 (05-1416 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2% BSA in 0.1% PBS-Tx and stained with rabbit anti-human tau antibodies (1:1000; Dako) or mouse anti-phospho tau PHF-1 (1:1000 – thermofisher) ...
-
bioRxiv - Immunology 2021Quote: ... FcR binding was quantified by incubating immune complexes with biotinylated FcRs (FcγR2A-1, FcγR2A-2, FcγR3A, courtesy of Duke Protein Production Facility) conjugated to Steptavidin-PE (Prozyme). Flow cytometry was performed with an IQue (Intellicyt ...
-
bioRxiv - Immunology 2020Quote: ... consistently identified GFAP peptides while minimizing nonspecific off-target peptide identification (Agilent Z033429-2, 1:200 dilution). Each peptide was required to have a minimum of 1 RPK as well as a FC > 10 ...
-
bioRxiv - Immunology 2021Quote: ... or goat anti-rabbit IgG (250 ng ml−1, 2.5% BSA in PBST; Dako, (Dako, P044801-2) at room temperature for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... or goat anti-rabbit IgG (250 ng ml−1, 2.5% BSA in PBST; Dako, (Dako, P044801-2) at room temperature for 1 h ...
-
bioRxiv - Bioengineering 2022Quote: ... anti-mouse-IgG conjugated to horseradish peroxidase (1:10,000, cat. no. P016102-2; Dako, Carpinteria, CA, USA), anti-rabbit StarBright 700 (1:2500 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2-deoxy-d-glucose (50 mM 2-DG, Agilent Technologies) as a glycolysis inhibitor ...
-
bioRxiv - Cell Biology 2024Quote: ... 3,3’-diaminobenzidine (DAB) substrate (Agilent Cat#GV82511-2 or GV92511-2), Dako REAL Peroxidase-blocking reagent (Agilent S202386-2) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The hybridisation mix was prepared by mixing the specified amounts of RNA with 10× Gene Expression Blocking Agent (1× final conc.) and 2× Hi-RPM Hybridization Buffer (1× final conc.) (Agilent, Cat No. 5188-5242) in a final volume of 42 μl ...
-
bioRxiv - Genetics 2019Quote: ... A DNA fragment corresponding to the 700 bp upstream region of the PaPKS1 ORF was amplified with oligonucleotides 5’ tcgccgcggGCTAGGGGGTACTGATGGG 3’ and 5’ cacgcggccgcCTTGGAAGCCTGTTGACGG 3’ (capital letters correspond to P. anserina genomic DNA sequences) and cloned in SKpBluescript vector (Stratagene) containing the nourseothricin-resistance gene Nat in the EcoRV site (vector named P1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... pBMN-HIPK4-Y175F-3xFLAG-IRES-mCherry was later generated by site-directed mutagenesis of the wild type construct using the primers 5’-CGCTATGTGAAGGAGCCTTTCATCCAGTCCCGCTTC TAC-3’ and 5’-GTAGAA GCGGGACTGGATGAAAGGCTCCTTCACATAGCG-3’ and PfuUltra II Fusion polymerase (Agilent).
-
bioRxiv - Physiology 2020Quote: ... Acetone was measured using an agilent DB-35MS column (30 m 3 0.25mm i.d. 3 0.25 mm, Agilent J&W Scientific) installed in an Agilent 7890A gas chromatograph (GC ...
-
bioRxiv - Genetics 2022Quote: ... plasmids using oligonucleotides containing the M68T missense mutation (Fwd 5’GAAAATACGTACCGTGACCTCTCGTCCAGATAGGGTCATCAGTGACC 3’, Rev 5’GGTCACTGATGACCCTATCTGGACGAGAGGTCACGGTACGTATTTTC 3’) and the QuikChange II Site-Directed Mutagenesis Kit (Agilent). The mtr4-F7A-F10A (pAC4099 ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR amplification of the full-length 16S rRNA gene with universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGACTT-3’) (Miller et al. 2013)was performed by using the Pfu Turbo DNA polymerase (Agilent) under the following conditions ...
-
bioRxiv - Biophysics 2024Quote: ... using a 3 × 3 mm black walls quartz cell at 25 °C on an Agilent Cary Eclipse spectrofluorometer (Agilent Technologies) equipped with a thermostatted cell holder attached to an Agilent PCB 1500 water Peltier system ...
-
bioRxiv - Bioengineering 2019Quote: ... Stage 6 clusters were loaded into islet capture microplates (Agilent; 101122-100) in RPMI with 2 mM glucose ...
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct ...
-
bioRxiv - Biochemistry 2023Quote: ... Antigen retrieval was performed with Citrate Buffer (pH 6) (Dako, Glostrup, Denmark). Immunohistochemical staining was performed with anti VEGFA or anti-S100A8 (Table I) ...
-
bioRxiv - Immunology 2019Quote: ... and 20μg/mL anti-Ki67 (TEC-3, Dako) antibodies diluted in TBS with 2% donkey serum for 3 hours at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fragment 3 was pBluescript KS (-) (Stratagene, California USA), which was digested using Xba ...